Transcript: Human XM_024452388.1

PREDICTED: Homo sapiens G protein-coupled receptor 143 (GPR143), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR143 (4935)
Length:
1321
CDS:
26..988

Additional Resources:

NCBI RefSeq record:
XM_024452388.1
NBCI Gene record:
GPR143 (4935)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452388.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422788 GATATCAATGGAGGTTCTTTG pLKO_005 596 CDS 100% 10.800 15.120 N GPR143 n/a
2 TRCN0000011780 GCCGTGATCAAGATCCGATTT pLKO.1 491 CDS 100% 10.800 8.640 N GPR143 n/a
3 TRCN0000429165 TATTTGTTGGTTGTCGAATAT pLKO_005 535 CDS 100% 13.200 9.240 N GPR143 n/a
4 TRCN0000431254 GCTATGCAGTGGATGCTTATC pLKO_005 180 CDS 100% 10.800 7.560 N GPR143 n/a
5 TRCN0000011779 GACTCAACAATTCTTGTTCTT pLKO.1 1026 3UTR 100% 4.950 3.465 N GPR143 n/a
6 TRCN0000424088 ACAAGGCATTTACACGGAGAA pLKO_005 454 CDS 100% 4.050 2.835 N GPR143 n/a
7 TRCN0000009235 CGGATATGAACCACACGGAAA pLKO.1 81 CDS 100% 4.050 2.835 N GPR143 n/a
8 TRCN0000009233 CGTGTGGTTAGGATTCCCAAA pLKO.1 43 CDS 100% 4.050 2.835 N GPR143 n/a
9 TRCN0000009234 CCACATGGTTTATTATGGGAA pLKO.1 642 CDS 100% 2.640 1.848 N GPR143 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452388.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488323 GAACACATCACCCAAAATATCTGA pLX_317 24% 75.4% 75.4% V5 (not translated due to prior stop codon) 0_1ins312 n/a
2 TRCN0000489507 GATTCGATGTGGCGGGCTAATGAC pLX_317 29.1% 75.3% 75.4% V5 0_1ins312;959_960delTA n/a
Download CSV