Construct: ORF TRCN0000488351
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020963.1_s317c1
- DNA Barcode:
- AGATACTCTTGGCACCATCCGGTA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- SCTR (6344)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488351
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6344 | SCTR | secretin receptor | NM_002980.2 | 99.8% | 99.7% | 652G>A;1176T>C |
| 2 | human | 6344 | SCTR | secretin receptor | XM_011511621.2 | 98.7% | 98.6% | 652G>A;851_865del;1191T>C |
| 3 | human | 6344 | SCTR | secretin receptor | XM_017004670.1 | 94.7% | 93.7% | (many diffs) |
| 4 | human | 6344 | SCTR | secretin receptor | XM_017004671.1 | 90.6% | 90.5% | (many diffs) |
| 5 | human | 6344 | SCTR | secretin receptor | XM_024453038.1 | 84.3% | 84.3% | 0_1ins204;448G>A;972T>C |
| 6 | human | 6344 | SCTR | secretin receptor | XM_017004672.1 | 83.4% | 83.3% | (many diffs) |
| 7 | human | 6344 | SCTR | secretin receptor | XR_922984.2 | 66.7% | (many diffs) | |
| 8 | human | 6344 | SCTR | secretin receptor | XR_001738887.1 | 62.6% | (many diffs) | |
| 9 | human | 6344 | SCTR | secretin receptor | XR_001738889.1 | 60.3% | (many diffs) | |
| 10 | human | 6344 | SCTR | secretin receptor | XM_005263730.5 | 59.3% | 59.3% | 0_1ins534;118G>A;642T>C |
| 11 | human | 6344 | SCTR | secretin receptor | XM_017004673.1 | 58.7% | 58.6% | (many diffs) |
| 12 | human | 6344 | SCTR | secretin receptor | XR_001738888.1 | 54.1% | (many diffs) | |
| 13 | mouse | 319229 | Sctr | secretin receptor | XM_006529688.3 | 70.3% | 69.3% | (many diffs) |
| 14 | mouse | 319229 | Sctr | secretin receptor | XM_011248029.1 | 70.3% | 69.3% | (many diffs) |
| 15 | mouse | 319229 | Sctr | secretin receptor | XM_011248030.2 | 70.3% | 69.3% | (many diffs) |
| 16 | mouse | 319229 | Sctr | secretin receptor | XM_011248031.2 | 66.6% | 65.8% | (many diffs) |
| 17 | mouse | 319229 | Sctr | secretin receptor | XM_006529689.3 | 58.6% | 54.9% | (many diffs) |
| 18 | mouse | 319229 | Sctr | secretin receptor | XM_006529690.3 | 42.9% | 42.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1392
- ORF length:
- 1320
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcgtccc cacctgtcgc cgccgctgca gcagctacta ctgccggtgc 121 tgctcgcctg cgccgcgcac tcgactggag cccttccccg actatgtgac gtgctacaag 181 tgctgtggga agagcaagac cagtgcctgc aggaactctc cagagagcag acaggagacc 241 tgggcacgga gcagccagtg ccaggttgtg aggggatgtg ggacaacata agctgctggc 301 cctcttctgt gccgggccgg atggtggagg tggaatgccc gagattcctc cggatgctca 361 ccagcagaaa tggttccttg ttccgaaact gcacacagga tggctggtca gaaaccttcc 421 ccaggcctaa tctggcctgt ggcgttaatg tgaacgactc ttccaacgag aagcggcact 481 cctacctgct gaagctgaaa gtcatgtaca ccgtgggcta cagctcctcc ctggtcatgc 541 tcctggtcgc ccttggcatc ctctgtgctt tccggaggct ccactgcact cgcaactaca 601 tccacatgca cctgttcgtg tccttcatcc ttcgtgccct gtccaacttc atcaaggacg 661 ccgtgctctt ctcctcagat gatgtcacct actgcgatgc ccacagggcg ggctgcaagc 721 tgatcatggt gctgttccag tactgcatca tggccaacta ctcctggctg ctggtggaag 781 gcctctacct tcacacactc ctcgccatct ccttcttctc tgaaagaaag tacctccagg 841 gatttgtggc attcggatgg ggttctccag ccatttttgt tgctttgtgg gctattgcca 901 gacactttct ggaagatgtt gggtgctggg acatcaatgc caacgcatcc atctggtgga 961 tcattcgtgg tcctgtgatc ctctccatcc tgattaattt catccttttc ataaacattc 1021 taagaatccT GATGAGAAAA CTTAGAACCC AAGAAACAAG AGGAAATGAA GTCAGCCATT 1081 ATAAGCGCCT GGCCAGGTCC ACTCTCCTGC TGATCCCCCT CTTTGGCATC CACTACATCG 1141 TCTTCGCCTT CTCCCCAGAG GACGCTATGG AGATCCAGCT GTTTTTTGAA CTAGCCCTTG 1201 GCTCATTCCA GGGACTGGTG GTGGCCGTCC TCTACTGCTT CCTCAACGGG GAGGTGCAGC 1261 TGGAGGTTCA GAAGAAGTGG CAGCAATGGC ACCTCCGTGA GTTCCCACTG CACCCCGTGG 1321 CCTCCTTCAG CAACAGCACC AAGGCCAGCC ACTTGGAGCA GAGCCAGGGC ACCTGCAGGA 1381 CCAGCATCAT CTAGGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1441 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1501 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AGATACTCTT GGCACCATCC 1561 GGTAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt