Transcript: Human XM_011511621.2

PREDICTED: Homo sapiens secretin receptor (SCTR), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCTR (6344)
Length:
1838
CDS:
227..1564

Additional Resources:

NCBI RefSeq record:
XM_011511621.2
NBCI Gene record:
SCTR (6344)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511621.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363148 GAACTAGCCCTTGGCTCATTC pLKO_005 1358 CDS 100% 10.800 15.120 N SCTR n/a
2 TRCN0000014350 GCATCCATCTGGTGGATCATT pLKO.1 1115 CDS 100% 0.563 0.788 N SCTR n/a
3 TRCN0000363203 TTGTTGCTTTGTGGGCTATTG pLKO_005 1032 CDS 100% 10.800 7.560 N SCTR n/a
4 TRCN0000014349 GCGTTAATGTGAACGACTCTT pLKO.1 597 CDS 100% 4.950 3.465 N SCTR n/a
5 TRCN0000014348 TGTCCTCCTTCAGCTGAAGAT pLKO.1 1663 3UTR 100% 4.950 3.465 N SCTR n/a
6 TRCN0000014351 GCCGTGCTCTTCTCCTCAGAT pLKO.1 815 CDS 100% 1.650 1.155 N SCTR n/a
7 TRCN0000014352 GAAATGAAGTCAGCCATTATA pLKO.1 1233 CDS 100% 15.000 9.000 N SCTR n/a
8 TRCN0000363144 GATCCTCTCCATCCTGATTAA pLKO_005 1147 CDS 100% 13.200 7.920 N SCTR n/a
9 TRCN0000378672 GGAAATGAAGTCAGCCATTAT pLKO_005 1232 CDS 100% 13.200 7.920 N SCTR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511621.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06917 pDONR223 100% 98.7% 98.6% None 652G>A;851_865del;1191T>C n/a
2 ccsbBroad304_06917 pLX_304 0% 98.7% 98.6% V5 652G>A;851_865del;1191T>C n/a
3 TRCN0000473821 GCACTCCTTATTAGGAGCTCTTAA pLX_317 39.7% 98.6% 59.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488351 AGATACTCTTGGCACCATCCGGTA pLX_317 27.8% 98.7% 98.6% V5 (not translated due to prior stop codon) 652G>A;851_865del;1191T>C n/a
5 TRCN0000489339 TAGATTACTAGTCTCCAAAAACCT pLX_317 27.6% 98.6% 98.4% V5 (many diffs) n/a
Download CSV