Construct: ORF TRCN0000488369
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021340.1_s317c1
- DNA Barcode:
- GTTCTGTGCTATATCCTTGACGTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- XRCC4 (7518)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488369
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7518 | XRCC4 | X-ray repair cross compleme... | NM_001318013.2 | 100% | 100% | |
| 2 | human | 7518 | XRCC4 | X-ray repair cross compleme... | XM_017009828.2 | 97.1% | 97.4% | (many diffs) |
| 3 | human | 7518 | XRCC4 | X-ray repair cross compleme... | XM_017009827.2 | 95% | 95.8% | (many diffs) |
| 4 | human | 7518 | XRCC4 | X-ray repair cross compleme... | NM_003401.5 | 91.8% | 90.7% | (many diffs) |
| 5 | human | 7518 | XRCC4 | X-ray repair cross compleme... | NM_022550.3 | 91.8% | 90.7% | (many diffs) |
| 6 | human | 7518 | XRCC4 | X-ray repair cross compleme... | NM_001318012.2 | 91.4% | 90.1% | (many diffs) |
| 7 | human | 7518 | XRCC4 | X-ray repair cross compleme... | NM_022406.4 | 91.4% | 90.1% | (many diffs) |
| 8 | human | 7518 | XRCC4 | X-ray repair cross compleme... | XM_011543626.1 | 91.4% | 90.1% | (many diffs) |
| 9 | human | 7518 | XRCC4 | X-ray repair cross compleme... | XM_017009829.2 | 83% | 78.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1002
- ORF length:
- 930
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggagaga aaaataagca gaatccacct tgtttctgaa cccagtataa 121 ctcattttct acaagtatct tgggagaaaa cactggaatc tggttttgtt attacactta 181 ctgatggtca ttcagcatgg actgggacag tttctgaatc agagatttcc caagaagctg 241 atgacatggc aatggaaaaa gggaaatatg ttggtgaact gagaaaagca ttgttgtcag 301 gagcaggacc agctgatgta tacacgttta atttttctaa agagtcttgt tatttcttct 361 ttgagaaaaa cctgaaagat gtctcattca gacttggttc cttcaaccta gagaaagttg 421 aaaacccagc tgaagtcatt agagaactta tttgttattg cttggacacc attgcagaaa 481 atcaagccaa aaatgagcac ctgcagaaag aaaatgaaag gcttctgaga gattggaatg 541 atgttcaagg acgatttgaa aaatgtgtga gtgctaagga agctttggag actgatcttt 601 ataagcggtt tattctggtg ttgaatgaga agaaaacaaa aatcagaagt ttGCATAATA 661 AATTATTAAA TGCAGCTCAA GAACGAGAAA AGGACATCAA ACAAGAAGGG GAAACTGCAA 721 TCTGTTCTGA AATGACTGCT GACCGAGATC CAGTCTATGA TGAGAGTACT GATGAGGAAA 781 GTGAAAACCA AACTGATCTC TCTGGGTTGG CTTCAGCTGC TGTAAGTAAA GATGATTCCA 841 TTATTTCAAG TCTTGATGTC ACTGATATTG CACCAAGTAG AAAAAGGAGA CAGCGAATGC 901 AAAGAAATCT TGGGACAGAA CCTAAAATGG CTCCTCAGGA GAATCAGCTT CAAGAAAAGG 961 AAAAAGGGAG GAAGAAGGAG ACTTCAGAGA AAGAGGCCGT GTAGAACCCA GCTTTCTTGT 1021 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1081 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1141 GAAAGGACGA GTTCTGTGCT ATATCCTTGA CGTCACGCGT TAAGTCgaca atcaacctct 1201 ggattacaaa atttgtgaaa gatt