Transcript: Human NM_001318012.2

Homo sapiens X-ray repair cross complementing 4 (XRCC4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
XRCC4 (7518)
Length:
1682
CDS:
127..1137

Additional Resources:

NCBI RefSeq record:
NM_001318012.2
NBCI Gene record:
XRCC4 (7518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421915 ATGATGTTCAAGGACGATTTG pLKO_005 593 CDS 100% 10.800 15.120 N XRCC4 n/a
2 TRCN0000040116 CCAGCTGATGTATACACGTTT pLKO.1 364 CDS 100% 4.950 6.930 N XRCC4 n/a
3 TRCN0000436182 GTCTTGATGTCACTGATATTG pLKO_005 905 CDS 100% 13.200 9.240 N XRCC4 n/a
4 TRCN0000040114 CGGTTTATTCTGGTGTTGAAT pLKO.1 661 CDS 100% 5.625 3.938 N XRCC4 n/a
5 TRCN0000040115 GCTGCTGTAAGTAAAGATGAT pLKO.1 871 CDS 100% 4.950 3.465 N XRCC4 n/a
6 TRCN0000009874 TATTGCTTGGACACCATTGCA pLKO.1 511 CDS 100% 3.000 2.100 N XRCC4 n/a
7 TRCN0000009875 TGTGTGAGTGCTAAGGAAGCT pLKO.1 619 CDS 100% 2.640 1.848 N XRCC4 n/a
8 TRCN0000040117 CCTCAGGAGAATCAGCTTCAA pLKO.1 988 CDS 100% 4.950 2.970 N XRCC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01786 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01786 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478434 GACGATGTCTAACTCGCTCGGATC pLX_317 28.5% 100% 100% V5 n/a
4 TRCN0000488369 GTTCTGTGCTATATCCTTGACGTC pLX_317 37.8% 91.4% 90.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV