Construct: ORF TRCN0000488449
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021721.1_s317c1
- DNA Barcode:
- GACTTAACCCCCAGTGAGATAGCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- KIT (3815)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488449
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3815 | KIT | KIT proto-oncogene, recepto... | NM_001093772.1 | 42.4% | .4% | 1_1678del |
| 2 | human | 3815 | KIT | KIT proto-oncogene, recepto... | XM_005265742.3 | 42.4% | .4% | 1_1681del |
| 3 | human | 3815 | KIT | KIT proto-oncogene, recepto... | XM_017008180.1 | 42.3% | .4% | 1_1678del;2128_2129insGCA |
| 4 | human | 3815 | KIT | KIT proto-oncogene, recepto... | XM_017008179.1 | 42.3% | .4% | 1_1681del;2131_2132insGCA |
| 5 | human | 3815 | KIT | KIT proto-oncogene, recepto... | NM_000222.2 | 42.2% | .4% | 1_1690del |
| 6 | human | 3815 | KIT | KIT proto-oncogene, recepto... | XM_005265740.1 | 42.2% | .4% | 1_1693del |
| 7 | human | 3815 | KIT | KIT proto-oncogene, recepto... | XM_017008178.1 | 42.1% | .4% | 1_1690del;2140_2141insGCA |
| 8 | human | 3815 | KIT | KIT proto-oncogene, recepto... | XM_005265741.1 | 42.1% | .4% | 1_1693del;2143_2144insGCA |
| 9 | mouse | 16590 | Kit | KIT proto-oncogene receptor... | XM_017320687.1 | 37% | .2% | (many diffs) |
| 10 | mouse | 16590 | Kit | KIT proto-oncogene receptor... | NM_021099.3 | 36.5% | .2% | (many diffs) |
| 11 | mouse | 16590 | Kit | KIT proto-oncogene receptor... | NM_001122733.1 | 36.4% | .2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 67
- ORF end:
- 88
- ORF length:
- 21
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaattgg 61 agataaatgg aaacaattat gtttacatag acccaacaca acttccttat gatcacaaat 121 gggagtttcc cagaaacagg ctgagttttg ggaaaaccct gggtgctgga gctttcggga 181 aggttgttga ggcaactgct tatggcttaa ttaagtcaga tgcggccatg actgtcgctg 241 taaagatgct caagccgagt gcccatttga cagaacggga agccctcatg tctgaactca 301 aagtcctgag ttaccttggt aatcacatga atattgtgaa tctacttgga gcctgcacca 361 ttggagggcc caccctggtc attacagaat attgttgcta tggtgatctt ttgaattttt 421 tgagaagaaa acgtgattca tttatttgtt caaagcagga agatcatgca gaagctgcac 481 tttataagaa tcttctgcat tcaaaggagt cttcctgcag cgatagtact aatgagtaca 541 tggacatgaa acctggagtt tcttatgttg tcccaaccaa ggccgacaaa aggagatctg 601 tgagaatagg ctcatacata gaaagagatg tgactcccgc catcatggag gatgacgagt 661 tggccctaga cttagaagac ttgctgagct tttcttacca ggtggcaaag ggcatggctt 721 tcctcgcctc caagaattgt attcacagag acttggcagc cagaaatatc ctccttactc 781 atggtcggat cacaaagatt tgtgattttg gtctagccag agacatcaag aatgattcta 841 attatgtggt taaaggaaac gctcgactac ctgtgaagtg gatggcacct gaaagcattt 901 tcaactgtgt atacacgttt gaaagtgacg tctggtccta tgggattttt ctttGGGAGC 961 TGTTCTCTTT AGGAAGCAGC CCCTATCCTG GAATGCCGGT CGATTCTAAG TTCTACAAGA 1021 TGATCAAGGA AGGCTTCCGG ATGCTCAGCC CTGAACACGC ACCTGCTGAA ATGTATGACA 1081 TAATGAAGAC TTGCTGGGAT GCAGATCCCC TAAAAAGACC AACATTCAAG CAAATTGTTC 1141 AGCTAATTGA GAAGCAGATT TCAGAGAGCA CCAATCATAT TTACTCCAAC TTAGCAAACT 1201 GCAGCCCCAA CCGACAGAAG CCCGTGGTAG ACCATTCTGT GCGGATCAAT TCTGTCGGCA 1261 GCACCGCTTC CTCCTCCCAG CCTCTGCTTG TGCACGACGA TGTCTGAGAC CCAGCTTTCT 1321 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1381 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1441 GTGGAAAGGA CGAGACTTAA CCCCCAGTGA GATAGCCACG CGTTAAGTCg acaatcaacc 1501 tctggattac aaaatttgtg aaagatt