Transcript: Mouse NM_001122733.1

Mus musculus KIT proto-oncogene receptor tyrosine kinase (Kit), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Kit (16590)
Length:
5205
CDS:
66..3005

Additional Resources:

NCBI RefSeq record:
NM_001122733.1
NBCI Gene record:
Kit (16590)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001122733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361295 ACTTCGCCTGACCAGATTAAA pLKO_005 1202 CDS 100% 15.000 21.000 N Kit n/a
2 TRCN0000023669 GCAAGAATAGACTCGTACATA pLKO.1 2295 CDS 100% 5.625 7.875 N Kit n/a
3 TRCN0000023672 CGACTTTGTCAGATGGACTTT pLKO.1 248 CDS 100% 4.950 6.930 N Kit n/a
4 TRCN0000023671 CGGATCACAAAGATTTGCGAT pLKO.1 2481 CDS 100% 2.640 3.696 N Kit n/a
5 TRCN0000023673 CCGACGCAACTTCCTTATGAT pLKO.1 1791 CDS 100% 5.625 4.500 N Kit n/a
6 TRCN0000195108 CCCTGGTCATTACAGAATATT pLKO.1 2071 CDS 100% 15.000 10.500 N KIT n/a
7 TRCN0000361294 CCTTAATGATGGGAGATATAT pLKO_005 3433 3UTR 100% 15.000 10.500 N Kit n/a
8 TRCN0000361296 ATGGACTTTCAAGACCTATTT pLKO_005 260 CDS 100% 13.200 9.240 N Kit n/a
9 TRCN0000368020 GACGTACGACAGGCTCATAAA pLKO_005 1322 CDS 100% 13.200 9.240 N Kit n/a
10 TRCN0000023670 CGGCTAACAAAGGGAAGGATT pLKO.1 1138 CDS 100% 4.950 3.465 N Kit n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488449 GACTTAACCCCCAGTGAGATAGCC pLX_317 28.8% 36.4% .2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV