Construct: ORF TRCN0000488502
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020864.1_s317c1
- DNA Barcode:
- TTCTGCCAAATGCTTAATTTAAAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- ADORA3 (140)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488502
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 140 | ADORA3 | adenosine A3 receptor | NM_000677.4 | 99.7% | 100% | 882T>C;897T>C |
| 2 | human | 140 | ADORA3 | adenosine A3 receptor | NM_001302679.2 | 54.1% | 54.4% | 0_1ins435;447T>C;462T>C |
| 3 | human | 140 | ADORA3 | adenosine A3 receptor | NM_001302678.2 | 38.2% | 36.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1026
- ORF length:
- 954
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcccaac aacagcactg ctctgtcatt ggccaatgtt acctacatca 121 ccatggaaat tttcattgga ctctgcgcca tagtgggcaa cgtgctggtc atctgcgtgg 181 tcaagctgaa ccccagcctg cagaccacca ccttctattt cattgtctct ctagccctgg 241 ctgacattgc tgttggggtg ctggtcatgc ctttggccat tgttgtcagc ctgggcatca 301 caatccactt ctacagctgc ctttttatga cttgcctact gcttatcttt acccacgcct 361 ccatcatgtc cttgctggcc atcgctgtgg accgatactt gcgggtcaag cttaccgtca 421 gatacaagag ggtcaccact cacagaagaa tatggctggc cctgggcctt tgctggctgg 481 tgtcattcct ggtgggattg acccccatgt ttggctggaa catgaaactg acctcagagt 541 accacagaaa tgtcaccttc ctttcatgcc aatttgtttc cgtcatgaga atggactaca 601 tggtatactt cagcttcctc acctggattt tcatccccct ggttgtcatg tgcgccatct 661 atcttgacat cttttacatc attcggaaCA AACTCAGTCT GAACTTATCT AACTCCAAAG 721 AGACAGGTGC ATTTTATGGA CGGGAGTTCA AGACGGCTAA GTCCTTGTTT CTGGTTCTTT 781 TCTTGTTTGC TCTGTCATGG CTGCCTTTAT CTATCATCAA CTGCATCATC TACTTTAATG 841 GTGAGGTACC ACAGCTTGTG CTGTACATGG GCATCCTGCT GTCCCATGCC AACTCCATGA 901 TGAACCCTAT CGTCTATGCC TATAAAATAA AGAAGTTCAA GGAAACCTAC CTCTTGATCC 961 TCAAAGCCTG TGTGGTCTGC CATCCCTCTG ATTCTTTGGA CACAAGCATT GAGAAGAATT 1021 CTGAGTAGGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1081 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1141 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATTCTGC CAAATGCTTA ATTTAAAAAC 1201 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt