Transcript: Human NM_001302679.2

Homo sapiens adenosine A3 receptor (ADORA3), transcript variant C, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ADORA3 (140)
Length:
1263
CDS:
221..742

Additional Resources:

NCBI RefSeq record:
NM_001302679.2
NBCI Gene record:
ADORA3 (140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001302679.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008047 CCTATCGTCTATGCCTATAAA pLKO.1 620 CDS 100% 15.000 21.000 N ADORA3 n/a
2 TRCN0000008050 CGTCATGAGAATGGACTACAT pLKO.1 295 CDS 100% 4.950 6.930 N ADORA3 n/a
3 TRCN0000008048 GCCATCTATCTTGACATCTTT pLKO.1 368 CDS 100% 5.625 3.938 N ADORA3 n/a
4 TRCN0000008046 CCCAATAGAAGAATAAGTCAT pLKO.1 1015 3UTR 100% 4.950 3.465 N ADORA3 n/a
5 TRCN0000008049 GCTAAGTCCTTGTTTCTGGTT pLKO.1 470 CDS 100% 2.640 1.848 N ADORA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302679.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05783 pDONR223 100% 54.1% 54.4% None 0_1ins435;447T>C;462T>C n/a
2 ccsbBroad304_05783 pLX_304 0% 54.1% 54.4% V5 0_1ins435;447T>C;462T>C n/a
3 TRCN0000474239 CCCGTTGACTATAGAAGCCAATAA pLX_317 48.9% 54.1% 54.4% V5 0_1ins435;447T>C;462T>C n/a
4 TRCN0000488502 TTCTGCCAAATGCTTAATTTAAAA pLX_317 35.7% 54.1% 54.4% V5 (not translated due to prior stop codon) 0_1ins435;447T>C;462T>C n/a
Download CSV