Construct: ORF TRCN0000488505
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020827.1_s317c1
- DNA Barcode:
- CCACCAGTCCTGTGGGGGACTACA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- P2RY14 (9934)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488505
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9934 | P2RY14 | purinergic receptor P2Y14 | NM_001081455.2 | 100% | 100% | |
| 2 | human | 9934 | P2RY14 | purinergic receptor P2Y14 | NM_014879.4 | 100% | 100% | |
| 3 | human | 9934 | P2RY14 | purinergic receptor P2Y14 | XM_005247922.3 | 100% | 100% | |
| 4 | human | 9934 | P2RY14 | purinergic receptor P2Y14 | XM_005247923.3 | 100% | 100% | |
| 5 | human | 9934 | P2RY14 | purinergic receptor P2Y14 | XM_011513340.3 | 100% | 100% | |
| 6 | human | 9934 | P2RY14 | purinergic receptor P2Y14 | XM_017007583.2 | 100% | 100% |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1086
- ORF length:
- 1014
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgatcaat tcaacctcca cacagcctcc agatgaatcc tgctctcaga 121 acctcctgat cactcagcag atcattcctg tgctgtactg tatggtcttc attgcaggaa 181 tcctactcaa tggagtgtca ggatggatat tcttttacgt gcccagctct aagagtttca 241 tcatctatct caagaacatt gttattgctg actttgtgat gagcctgact tttcctttca 301 agatccttgg tgactcaggc cttggtccct ggcagctgaa cgtgtttgtg tgcagggtct 361 ctgccgtgct cttctacgtc aacatgtacg tcagcattgt gttctttggg ctcatcagct 421 ttgacagata ttataaaatt gtaaagcctc tttggacttc tttcatccag tcagtgagtt 481 acagcaaact tctgtcagtg atagtatgga tgctcatgct cctccttgct gttccaaata 541 ttattctcac caaccagagt gttagggagg ttacacaaat aaaatgtata gaactgaaaa 601 gtgaactggg acggaagtgg cacaaagcat caaactacat cttcgtggcc atcttctgga 661 ttgtgtttct tttgttaatc gttttctata ctgctatcac aaagaaaatc tttaagtccc 721 accttaagtc aagtcggaat tccacttcgg TCAAAAAGAA ATCTAGCCGC AACATATTCA 781 GCATCGTGTT TGTGTTTTTT GTCTGTTTTG TACCTTACCA TATTGCCAGA ATCCCCTACA 841 CAAAGAGTCA GACCGAAGCT CATTACAGCT GCCAGTCAAA AGAAATCTTG CGGTATATGA 901 AAGAATTCAC TCTGCTACTA TCTGCTGCAA ATGTATGCTT GGACCCTATT ATTTATTTCT 961 TTCTATGCCA GCCGTTTAGG GAAATCTTAT GTAAGAAATT GCACATTCCA TTAAAAGCTC 1021 AGAATGACCT AGACATTTCC AGAATCAAAA GAGGAAATAC AACACTTGAA AGCACAGATA 1081 CTTTGTAGGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1141 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1201 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACCACCA GTCCTGTGGG GGACTACAAC 1261 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt