Transcript: Human XM_017007583.2

PREDICTED: Homo sapiens purinergic receptor P2Y14 (P2RY14), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
P2RY14 (9934)
Length:
3276
CDS:
1075..2091

Additional Resources:

NCBI RefSeq record:
XM_017007583.2
NBCI Gene record:
P2RY14 (9934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011517 GCTCAGAATGACCTAGACATT pLKO.1 2020 CDS 100% 4.950 6.930 N P2RY14 n/a
2 TRCN0000357098 GTATGCTTGGACCCTATTATT pLKO_005 1936 CDS 100% 15.000 12.000 N P2RY14 n/a
3 TRCN0000011513 CCCATCAGTAATTTCTCTAAT pLKO.1 2272 3UTR 100% 13.200 9.240 N P2RY14 n/a
4 TRCN0000357100 GAAATCTAGCCGCAACATATT pLKO_005 1761 CDS 100% 13.200 9.240 N P2RY14 n/a
5 TRCN0000357099 TAGCACTGCCATCCAATTTAG pLKO_005 2194 3UTR 100% 13.200 9.240 N P2RY14 n/a
6 TRCN0000011514 CCAGCCGTTTAGGGAAATCTT pLKO.1 1971 CDS 100% 5.625 3.938 N P2RY14 n/a
7 TRCN0000011515 CGTGCTCTTCTACGTCAACAT pLKO.1 1368 CDS 100% 4.950 3.465 N P2RY14 n/a
8 TRCN0000011516 GCTGTACTGTATGGTCTTCAT pLKO.1 1155 CDS 100% 4.950 3.465 N P2RY14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488505 CCACCAGTCCTGTGGGGGACTACA pLX_317 33.4% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000487993 TTTGCACCAGAAATGGTCCCGAAC pLX_317 25.4% 99.9% 99.7% V5 1014_1015insG n/a
3 ccsbBroadEn_07513 pDONR223 100% 99.9% 99.7% None 160A>G n/a
4 ccsbBroad304_07513 pLX_304 0% 99.9% 99.7% V5 160A>G n/a
Download CSV