Construct: ORF TRCN0000488528
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020837.1_s317c1
- DNA Barcode:
- TACTGAGACAGTGTGGCGGCATGG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CXCR1 (3577)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488528
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3577 | CXCR1 | C-X-C motif chemokine recep... | NM_000634.3 | 99.8% | 99.4% | 92T>G;1003C>T |
| 2 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | NM_001168298.2 | 81.5% | 75.2% | (many diffs) |
| 3 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | NM_001557.4 | 81.5% | 75.2% | (many diffs) |
| 4 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_005246530.3 | 81.5% | 75.2% | (many diffs) |
| 5 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003990.1 | 81.5% | 75.2% | (many diffs) |
| 6 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003991.1 | 81.5% | 75.2% | (many diffs) |
| 7 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003992.1 | 81.5% | 75.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1122
- ORF length:
- 1050
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtcaaat attacagatc cacagatgtg ggattttgat gatctaaatt 121 tcactggcat gccacctgca gatgaagatt acagcccctg taggctagaa actgagacac 181 tcaacaagta tgttgtgatc atcgcctatg ccctagtgtt cctgctgagc ctgctgggaa 241 actccctggt gatgctggtc atcttataca gcagggtcgg ccgctccgtc actgatgtct 301 acctgctgaa cctggccttg gccgacctac tctttgccct gaccttgccc atctgggccg 361 cctccaaggt gaatggctgg atttttggca cattcctgtg caaggtggtc tcactcctga 421 aggaagtcaa cttctacagt ggcatcctgc tgttggcctg catcagtgtg gaccgttacc 481 tggccattgt ccatgccaca cgcacactga cccagaagcg tcacttggtc aagtttgttt 541 gtcttggctg ctggggactg tctatgaatc tgtccctgcc cttcttcctt ttccgccagg 601 cttaccatcc aaacaattcc agtccagttt gctatgaggt cctgggaaat gacacagcaa 661 aatggcggat ggtgttgcgg atcctgcctc acacctttgg cttcatcgtg ccgctgtttg 721 tcatgctgtt ctgctatgga ttcaccctgc gtacactgtt taaggcccac atgGGGCAGA 781 AGCACCGAGC CATGAGGGTC ATCTTTGCTG TCGTCCTCAT CTTCCTGCTT TGCTGGCTGC 841 CCTACAACCT GGTCCTGCTG GCAGACACCC TCATGAGGAC CCAGGTGATC CAGGAGAGCT 901 GTGAGCGCCG CAACAACATC GGCCGGGCCC TGGATGCCAC TGAGATTCTG GGATTTCTCC 961 ATAGCTGCCT CAACCCCATC ATCTACGCCT TCATCGGCCA AAATTTTCGC CATGGATTCC 1021 TCAAGATCCT GGCTATGCAT GGCCTGGTCA GCAAGGAGTT CTTGGCACGT CATTGTGTTA 1081 CCTCCTACAC TTCTTCGTCT GTCAATGTCT CTTCCAACCT CTAGGACCCA GCTTTCTTGT 1141 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1201 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1261 GAAAGGACGA TACTGAGACA GTGTGGCGGC ATGGACGCGT TAAGTCgaca atcaacctct 1321 ggattacaaa atttgtgaaa gatt