Transcript: Human XM_017003991.1

PREDICTED: Homo sapiens C-X-C motif chemokine receptor 2 (CXCR2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CXCR2 (3579)
Length:
2533
CDS:
82..1164

Additional Resources:

NCBI RefSeq record:
XM_017003991.1
NBCI Gene record:
CXCR2 (3579)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378365 GAAGCGCTACTTGGTCAAATT pLKO_005 552 CDS 100% 13.200 18.480 N CXCR2 n/a
2 TRCN0000009136 GCCACTAAATTGACACTTAAA pLKO.1 2325 3UTR 100% 13.200 10.560 N CXCR2 n/a
3 TRCN0000009137 CCCTGGAAATCAACAAGTATT pLKO.1 209 CDS 100% 13.200 9.240 N CXCR2 n/a
4 TRCN0000378298 CTCATTAGGATGGCTAGTATC pLKO_005 1472 3UTR 100% 10.800 7.560 N CXCR2 n/a
5 TRCN0000357513 TCCTCAAGATTCTAGCTATAC pLKO_005 1055 CDS 100% 10.800 7.560 N CXCR2 n/a
6 TRCN0000009138 CCGTCTACTCATCCAATGTTA pLKO.1 638 CDS 100% 5.625 3.938 N CXCR2 n/a
7 TRCN0000009140 CGCTACTTGGTCAAATTCATA pLKO.1 556 CDS 100% 5.625 3.938 N CXCR2 n/a
8 TRCN0000009139 GCACACTTCCACTACTCTCTA pLKO.1 1143 CDS 100% 4.950 2.475 Y CXCR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00856 pDONR223 100% 100% 100% None n/a
2 TRCN0000489434 TGACCCGCTTATTCTAAAAAATCG pLX_317 31.4% 99.9% 100% V5 (not translated due to prior stop codon) 786C>T n/a
3 TRCN0000489938 CGAGAATGTGCGATCGATATATTA pLX_317 43.8% 99.7% 99.4% V5 786C>T;889G>A;1080_1081insG n/a
4 ccsbBroadEn_06442 pDONR223 100% 81.6% 75.2% None (many diffs) n/a
5 TRCN0000488528 TACTGAGACAGTGTGGCGGCATGG pLX_317 33.5% 81.5% 75.2% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491640 GCAGGTGACCAGCATCCGCATAGC pLX_317 28.8% 81.5% 75.2% V5 (many diffs) n/a
7 TRCN0000489020 GAGTATTACGAATGATACGACCCC pLX_317 29.2% 81.2% 75.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV