Construct: ORF TRCN0000488637
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020786.1_s317c1
- DNA Barcode:
- CCTACGTAACGGAGAAAAAAGAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR182 (11318)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488637
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11318 | GPR182 | G protein-coupled receptor 182 | NM_007264.4 | 100% | 100% | |
| 2 | human | 11318 | GPR182 | G protein-coupled receptor 182 | XM_011537824.3 | 100% | 100% | |
| 3 | human | 11318 | GPR182 | G protein-coupled receptor 182 | XM_011537825.3 | 100% | 100% | |
| 4 | human | 11318 | GPR182 | G protein-coupled receptor 182 | XM_011537827.3 | 100% | 100% |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1284
- ORF length:
- 1212
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtcagtg aaacccagct gggggcctgg cccctcggag ggggtcaccg 121 cagtgcctac cagtgacctt ggagagatcc acaactggac cgagctgctt gacctcttca 181 accacacttt gtctgagtgc cacgtggagc tcagccagag caccaagcgc gtggtcctct 241 ttgccctcta cctggccatg tttgtggttg ggctggtgga gaacctcctg gtgatatgcg 301 tcaactggcg cggctcaggc cgggcagggc tgatgaacct ctacatcctc aacatggcca 361 tcgcggacct gggcattgtc ctgtctctgc ccgtgtggat gctggaggtc acgctggact 421 acacctggct ctggggcagc ttctcctgcc gcttcactca ctacttctac tttgtcaaca 481 tgtatagcag catcttcttc ctggtgtgcc tcagtgtcga ccgctatgtc accctcacca 541 gcgcctcccc ctcctggcag cgttaccagc accgagtgcg gcgggccatg tgtgcaggca 601 tctgggtcct ctcggccatc atcccgctgc ctgaggtggt ccacatccag ctggtggagg 661 gccctgagcc catgtgcctc ttcatggcac cttttgaaac gtacagcacc tgggccctgg 721 cggtggccct gtccaccacc atcctgggct tcctgctgcc cttccctctc atcacagtct 781 tcaatgtgct gacagcctgc cggctgcggc agccaggaca acccaagagc cggcgccact 841 gcctgctgct gtgcgcctac gtggccgtct ttgtcatgtg ctggctgccc tatcatgtga 901 ccctgctgct gctcacactg catgggaccc acatctccct ccactgccac ctggtccacc 961 TGCTCTACTT CTTCTATGAT GTCATTGACT GCTTCTCCAT GCTGCACTGT GTCATCAACC 1021 CCATCCTTTA CAACTTTCTC AGCCCACACT TCCGGGGCCG GCTCCTGAAT GCTGTAGTCC 1081 ATTACCTTCC TAAGGACCAG ACCAAGGCGG GCACATGCGC CTCCTCTTCC TCCTGTTCCA 1141 CCCAGCATTC CATCATCATC ACCAAGGGTG ATAGCCAGCC TGCTGCAGCA GCCCCCCACC 1201 CTGAGCCAAG CCTGAGCTTT CAGGCACACC ATTTGCTTCC AAATACTTCC CCCATCTCTC 1261 CCACTCAGCC TCTTACACCC AGCTAGGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1321 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1381 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACCTACGTA 1441 ACGGAGAAAA AAGAACACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1501 aagatt