Transcript: Human NM_007264.4

Homo sapiens G protein-coupled receptor 182 (GPR182), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
GPR182 (11318)
Length:
3411
CDS:
174..1388

Additional Resources:

NCBI RefSeq record:
NM_007264.4
NBCI Gene record:
GPR182 (11318)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007264.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008032 CTACTTCTACTTTGTCAACAT pLKO.1 563 CDS 100% 4.950 3.960 N GPR182 n/a
2 TRCN0000356596 TCAAAGCACTCGTGGTCAATT pLKO_005 1475 3UTR 100% 13.200 9.240 N GPR182 n/a
3 TRCN0000356598 TCTACTTTGTCAACATGTATA pLKO_005 568 CDS 100% 13.200 9.240 N GPR182 n/a
4 TRCN0000356660 CCTGAATGCTGTAGTCCATTA pLKO_005 1166 CDS 100% 10.800 7.560 N GPR182 n/a
5 TRCN0000356661 GAGCTTTCAGGCACACCATTT pLKO_005 1316 CDS 100% 10.800 7.560 N GPR182 n/a
6 TRCN0000008033 CCTCTCATCACAGTCTTCAAT pLKO.1 867 CDS 100% 5.625 3.938 N GPR182 n/a
7 TRCN0000011225 AGGGCTGATGAACCTCTACAT pLKO.1 428 CDS 100% 4.950 3.465 N GPR182 n/a
8 TRCN0000008035 CTTCACTCACTACTTCTACTT pLKO.1 554 CDS 100% 4.950 3.465 N GPR182 n/a
9 TRCN0000008034 CTGTAGTCCATTACCTTCCTA pLKO.1 1174 CDS 100% 3.000 2.100 N GPR182 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007264.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02670 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02670 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465909 CCGATCGTATGCCCGGGCTACAGT pLX_317 27.6% 100% 100% V5 n/a
4 TRCN0000488637 CCTACGTAACGGAGAAAAAAGAAC pLX_317 27.1% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000488261 CCACGCTGCTAGGGAAGCCTGGGC pLX_317 26.9% 99.9% 99.7% V5 1212_1213insG n/a
Download CSV