Construct: ORF TRCN0000488691
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019415.1_s317c1
- DNA Barcode:
- TTATGTTCGGTTACCGACAGAGCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ADORA2A (135)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488691
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 135 | ADORA2A | adenosine A2a receptor | NM_000675.6 | 99.8% | 99.7% | 1083T>C;1236_1237insG |
| 2 | human | 135 | ADORA2A | adenosine A2a receptor | NM_001278497.1 | 99.8% | 99.7% | 1083T>C;1236_1237insG |
| 3 | human | 135 | ADORA2A | adenosine A2a receptor | NM_001278498.1 | 99.8% | 99.7% | 1083T>C;1236_1237insG |
| 4 | human | 135 | ADORA2A | adenosine A2a receptor | NM_001278499.2 | 99.8% | 99.7% | 1083T>C;1236_1237insG |
| 5 | human | 135 | ADORA2A | adenosine A2a receptor | NM_001278500.1 | 99.8% | 99.7% | 1083T>C;1236_1237insG |
| 6 | human | 135 | ADORA2A | adenosine A2a receptor | NR_103543.2 | 47.5% | (many diffs) | |
| 7 | human | 135 | ADORA2A | adenosine A2a receptor | NR_103544.2 | 47.4% | (many diffs) | |
| 8 | human | 101730217 | SPECC1L-ADORA2A | SPECC1L-ADORA2A readthrough... | NR_103546.1 | 19.6% | 1_4179del;5262T>C;5416_6289delinsG |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1314
- ORF length:
- 1239
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgccc atcatgggct cctcggtgta catcacggtg gagctggcca 121 ttgctgtgct ggccatcctg ggcaatgtgc tggtgtgctg ggccgtgtgg ctcaacagca 181 acctgcagaa cgtcaccaac tactttgtgg tgtcactggc ggcggccgac atcgcagtgg 241 gtgtgctcgc catccccttt gccatcacca tcagcaccgg gttctgcgct gcctgccacg 301 gctgcctctt cattgcctgc ttcgtcctgg tcctcacgca gagctccatc ttcagtctcc 361 tggccatcgc cattgaccgc tacattgcca tccgcatccc gctccggtac aatggcttgg 421 tgaccggcac gagggctaag ggcatcattg ccatctgctg ggtgctgtcg tttgccatcg 481 gcctgactcc catgctaggt tggaacaact gcggtcagcc aaaggagggc aagaaccact 541 cccagggctg cggggagggc caagtggcct gtctctttga ggatgtggtc cccatgaact 601 acatggtgta cttcaacttc tttgcctgtg tgctggtgcc cctgctgctc atgctgggtg 661 tctatttgcg gatcttcctg gcggcgcgac gacagctgaa gcagatggag agccagcctc 721 tgccggggga gcgggcacgg tccacactgc agaaggaggt ccatgctgcc aagtcactgg 781 ccatcattgt ggggctcttt gccctctgct ggctgcccct acacatcatc aactgcttca 841 ctttcttctg ccccgactgc agccacgccc ctctctggct catgtacctg gccatcgtcc 901 tctcccacac caattcggtt gtgaatccct tcatctacgc ctaccgtatc cgcgagttcc 961 gccagacctt ccgcaagatc attcgcagcc acgtcctgag gcagcaagaa CCTTTCAAGG 1021 CAGCTGGCAC CAGTGCCCGG GTCTTGGCAG CTCATGGCAG TGACGGAGAG CAGGTCAGCC 1081 TCCGTCTCAA CGGCCACCCG CCAGGAGTGT GGGCCAACGG CAGTGCTCCC CACCCTGAGC 1141 GGAGGCCCAA TGGCTACGCC CTGGGGCTGG TGAGTGGAGG GAGTGCCCAA GAGTCCCAGG 1201 GGAACACGGG CCTCCCAGAC GTGGAGCTCC TTAGCCATGA GCTCAAGGGA GTGTGCCCAG 1261 AGCCCCCTGG CCTAGATGAC CCCCTGGCCC AGGATGGAGC AGGAGTGTCC GACCCAGCTT 1321 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1381 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1441 CTTGTGGAAA GGACGATTAT GTTCGGTTAC CGACAGAGCT ACGCGTTAAG TCgacaatca 1501 acctctggat tacaaaattt gtgaaagatt