Transcript: Human NM_001278499.2

Homo sapiens adenosine A2a receptor (ADORA2A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ADORA2A (135)
Length:
2509
CDS:
403..1641

Additional Resources:

NCBI RefSeq record:
NM_001278499.2
NBCI Gene record:
ADORA2A (135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262499 CCTAAGGGAAGGAGATCTTTA pLKO_005 1664 3UTR 100% 13.200 6.600 Y ADORA2A n/a
2 TRCN0000356665 TGCTCATGCTGGGTGTCTATT pLKO_005 974 CDS 100% 13.200 6.600 Y ADORA2A n/a
3 TRCN0000262497 AGACCTTCCGCAAGATCATTC pLKO_005 1292 CDS 100% 10.800 5.400 Y ADORA2A n/a
4 TRCN0000262496 GCAGGAGTGTCCTGATGATTC pLKO_005 1627 CDS 100% 10.800 5.400 Y ADORA2A n/a
5 TRCN0000356603 TCGTCCTCTCCCACACCAATT pLKO_005 1223 CDS 100% 10.800 5.400 Y ADORA2A n/a
6 TRCN0000369167 TTCTGAGGAAGCAGATGTTTC pLKO_005 1826 3UTR 100% 10.800 5.400 Y ADORA2A n/a
7 TRCN0000262495 TTCATCTACGCCTACCGTATC pLKO_005 1258 CDS 100% 6.000 3.000 Y ADORA2A n/a
8 TRCN0000262498 CAGAACGTCACCAACTACTTT pLKO_005 514 CDS 100% 5.625 2.813 Y ADORA2A n/a
9 TRCN0000008042 CCACACCAATTCGGTTGTGAA pLKO.1 1233 CDS 100% 4.950 2.475 Y ADORA2A n/a
10 TRCN0000008045 CCATGCTAGGTTGGAACAACT pLKO.1 818 CDS 100% 4.950 2.475 Y ADORA2A n/a
11 TRCN0000008041 CCCAGAGGTGACATTTGACTT pLKO.1 2075 3UTR 100% 4.950 2.475 Y ADORA2A n/a
12 TRCN0000008043 CCTACACATCATCAACTGCTT pLKO.1 1146 CDS 100% 2.640 1.320 Y ADORA2A n/a
13 TRCN0000008044 GCTGGGTGTCTATTTGCGGAT pLKO.1 981 CDS 100% 2.160 1.080 Y ADORA2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05782 pDONR223 100% 99.9% 100% None 1083T>C n/a
2 ccsbBroad304_05782 pLX_304 0% 99.9% 100% V5 1083T>C n/a
3 TRCN0000467184 ACCTATTACAAAGACCAGTAGCTT pLX_317 33.7% 99.9% 100% V5 1083T>C n/a
4 TRCN0000487999 CTTTTAAACGAATCGTATGACAGA pLX_317 24.8% 99.9% 100% V5 (not translated due to prior stop codon) 1083T>C n/a
5 TRCN0000488017 GCCGAGTCGAGGCCTAAATCATTA pLX_317 24.8% 99.9% 100% V5 (not translated due to prior stop codon) 1083T>C n/a
6 TRCN0000488691 TTATGTTCGGTTACCGACAGAGCT pLX_317 24.5% 99.8% 99.7% V5 1083T>C;1236_1237insG n/a
7 TRCN0000488118 GCTAAACCCACCCTTCTGACCGAT pLX_317 24.7% 99.8% 99.7% V5 1083T>C;1236_1237insA n/a
Download CSV