Construct: ORF TRCN0000488703
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021559.1_s317c1
- DNA Barcode:
- AAGGGGGGGTATCGTTCACAGGCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- DUSP14 (11072)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488703
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11072 | DUSP14 | dual specificity phosphatas... | NM_007026.4 | 100% | 100% | |
| 2 | human | 11072 | DUSP14 | dual specificity phosphatas... | XM_005256977.3 | 100% | 100% | |
| 3 | human | 11072 | DUSP14 | dual specificity phosphatas... | XM_011524234.1 | 100% | 100% | |
| 4 | mouse | 56405 | Dusp14 | dual specificity phosphatas... | NM_019819.3 | 90.7% | 93.9% | (many diffs) |
| 5 | mouse | 56405 | Dusp14 | dual specificity phosphatas... | XM_006533796.4 | 90.7% | 93.9% | (many diffs) |
| 6 | mouse | 56405 | Dusp14 | dual specificity phosphatas... | XM_006533797.4 | 90.7% | 93.9% | (many diffs) |
| 7 | mouse | 56405 | Dusp14 | dual specificity phosphatas... | XM_006533798.4 | 90.7% | 93.9% | (many diffs) |
| 8 | mouse | 56405 | Dusp14 | dual specificity phosphatas... | XM_006533799.4 | 90.7% | 93.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 666
- ORF length:
- 594
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgagctcc agaggtcaca gcacgctacc aaggactctc atggcccctc 121 ggatgatttc cgagggagac ataggaggca ttgctcaaat cacctcctct ctattcctgg 181 gcagaggcag tgtggcctcc aatcggcacc tcctccaggc tcgtggcatc acctgcattg 241 ttaatgctac cattgagatc cctaatttca actggcccca atttgagtat gttaaagtgc 301 ctctggctga catgccgcat gcccccattg gactgtactt tgacaccgtg gctgacaaga 361 TCCACAGTGT GAGCAGGAAG CACGGGGCCA CCTTGGTGCA CTGTGCTGCA GGGGTGAGCC 421 GCTCAGCCAC GCTGTGTATC GCGTACCTGA TGAAATTCCA CAACGTGTGC CTGCTGGAGG 481 CGTACAACTG GGTGAAAGCC CGGCGACCTG TCATCAGGCC CAACGTAGGC TTCTGGAGGC 541 AACTGATAGA CTACGAGCGC CAGCTCTTTG GGAAGTCGAC AGTTAAAATG GTACAGACAC 601 CTTATGGCAT AGTTCCCGAC GTCTATGAGA AGGAGTCCCG ACACCTGATG CCTTACTGGG 661 GGATTTAGAA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 721 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 781 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAAAGGGG GGGTATCGTT CACAGGCAAC 841 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt