Transcript: Human NM_007026.4

Homo sapiens dual specificity phosphatase 14 (DUSP14), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
DUSP14 (11072)
Length:
1474
CDS:
249..845

Additional Resources:

NCBI RefSeq record:
NM_007026.4
NBCI Gene record:
DUSP14 (11072)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007026.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315036 GTATCGCGTACCTGATGAAAT pLKO_005 613 CDS 100% 13.200 18.480 N DUSP14 n/a
2 TRCN0000220133 GCCCAGGATTATATTAGCATT pLKO.1 1425 3UTR 100% 4.950 6.930 N DUSP14 n/a
3 TRCN0000220134 CGCGTACCTGATGAAATTCCA pLKO.1 617 CDS 100% 3.000 2.400 N DUSP14 n/a
4 TRCN0000315033 TACCATTGAGATCCCTAATTT pLKO_005 425 CDS 100% 0.000 0.000 N DUSP14 n/a
5 TRCN0000315032 ATGCTTAGGGAAGGTTGATAA pLKO_005 1255 3UTR 100% 13.200 9.240 N DUSP14 n/a
6 TRCN0000381634 CATAGGAGGCATTGCTCAAAT pLKO_005 317 CDS 100% 13.200 9.240 N DUSP14 n/a
7 TRCN0000315034 CTTTGGGAAGTCGACAGTTAA pLKO_005 743 CDS 100% 13.200 9.240 N DUSP14 n/a
8 TRCN0000220131 GCTCAAATCACCTCCTCTCTA pLKO.1 330 CDS 100% 4.950 3.465 N DUSP14 n/a
9 TRCN0000220130 GTACAGACACCTTATGGCATA pLKO.1 768 CDS 100% 4.050 2.835 N DUSP14 n/a
10 TRCN0000315031 GTACAGACACCTTATGGCATA pLKO_005 768 CDS 100% 4.050 2.835 N DUSP14 n/a
11 TRCN0000220132 TGCTACCATTGAGATCCCTAA pLKO.1 422 CDS 100% 4.050 2.835 N DUSP14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007026.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02612 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02612 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473282 AACTCTATAGGTTCATAGCCAAAT pLX_317 72.1% 100% 100% V5 n/a
4 TRCN0000488703 AAGGGGGGGTATCGTTCACAGGCA pLX_317 51.2% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV