Construct: ORF TRCN0000488718
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020317.1_s317c1
- DNA Barcode:
- CCCTAAGTTCTTCTAGCTCCTGGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- IDNK (414328)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488718
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 414328 | IDNK | IDNK gluconokinase | NM_001001551.4 | 100% | 100% | |
2 | human | 414328 | IDNK | IDNK gluconokinase | XM_006717111.4 | 91.9% | 87.8% | (many diffs) |
3 | human | 414328 | IDNK | IDNK gluconokinase | XM_006717110.3 | 78.2% | 74.3% | (many diffs) |
4 | human | 414328 | IDNK | IDNK gluconokinase | NM_001256915.1 | 75.4% | 75.4% | 0_1ins138 |
5 | human | 414328 | IDNK | IDNK gluconokinase | NM_001351535.2 | 75.4% | 75.4% | 0_1ins138 |
6 | human | 414328 | IDNK | IDNK gluconokinase | XM_017014724.1 | 75.4% | 75.4% | 0_1ins138 |
7 | human | 414328 | IDNK | IDNK gluconokinase | XM_017014719.1 | 62.2% | 68% | 1_151del;201_202ins118 |
8 | human | 414328 | IDNK | IDNK gluconokinase | NR_046421.2 | 56.6% | 1_29del;79_80ins31;560_905del | |
9 | human | 414328 | IDNK | IDNK gluconokinase | NR_046422.2 | 34.4% | (many diffs) | |
10 | human | 414328 | IDNK | IDNK gluconokinase | XM_017014720.1 | 30.3% | 24.5% | (many diffs) |
11 | human | 414328 | IDNK | IDNK gluconokinase | XM_017014721.1 | 18.6% | 13.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 633
- ORF length:
- 561
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcggcg ccgggcgcgc tgctggtgat gggcgtgagc ggctcgggga 121 aatccaccgt gggcgccctg ctggcatctg agctgggatg gaaattctat gatgctgatg 181 attatcaccc ggaggaaaat cgaaggaaga tgggaaaagg cataccgctc aatgaccagg 241 accggattcc atggctctgt aacttgcatg acattttact aagagatgta gcctcgggac 301 agcgtgtggt tctagcctgt tcagcccTGA AGAAAACGTA CAGAGACATA TTAACACAAG 361 GAAAAGATGG TGTAGCTCTG AAGTGTGAGG AGTCGGGAAA GGAAGCAAAG CAGGCTGAGA 421 TGCAGCTCCT GGTGGTCCAT CTGAGCGGGT CGTTTGAGGT CATCTCTGGA CGCTTACTCA 481 AAAGAGAGGG ACATTTTATG CCCCCTGAAT TATTGCAGTC CCAGTTTGAG ACTCTGGAGC 541 CCCCAGCAGC TCCAGAAAAC TTTATCCAAA TAAGTGTGGA CAAAAATGTT TCAGAGATAA 601 TTGCTACAAT TATGGAAACC CTAAAAATGA AATGAGACCC AGCTTTCTTG TACAAAGTGG 661 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 721 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 781 ACCCTAAGTT CTTCTAGCTC CTGGCACGCG TTAAGTCgac aatcaacctc tggattacaa 841 aatttgtgaa agatt