Construct: ORF TRCN0000488802
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020832.1_s317c1
- DNA Barcode:
- CACTCGAACGATTGCGGAGCGCAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR18 (2841)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488802
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2841 | GPR18 | G protein-coupled receptor 18 | NM_001098200.1 | 100% | 100% | |
| 2 | human | 2841 | GPR18 | G protein-coupled receptor 18 | NM_005292.3 | 100% | 100% | |
| 3 | human | 2841 | GPR18 | G protein-coupled receptor 18 | XM_006719946.3 | 100% | 100% | |
| 4 | human | 2841 | GPR18 | G protein-coupled receptor 18 | XM_024449339.1 | 100% | 100% | |
| 5 | mouse | 110168 | Gpr18 | G protein-coupled receptor 18 | NM_182806.1 | 82.5% | 85.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1065
- ORF length:
- 993
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgatcacc ctgaacaatc aagatcaacc tgtccctttt aacagctcac 121 atccagatga atacaaaatt gcagcccttg tcttctatag ctgtatcttc ataattggat 181 tatttgttaa catcactgca ttatgggttt tcagttgtac caccaagaag agaaccacgg 241 taaccatcta tatgatgaat gtggcattag tggacttgat atttataatg actttaccct 301 ttcgaatgtt ttattatgca aaagatgaat ggccatttgg agagtacttc tgccagattc 361 ttggagctct cacagtgttt tacccaagca ttgctttatg gcttcttgcc tttattagtg 421 ctgacagata catggccatt gtacagccga agtacgccaa agaacttaaa aacacgtgca 481 aagccgtgct ggcgtgtgtg ggagtctgga taatgaccct gaccacgacc acccctctgc 541 tactgctcta taaagaccca gataaagact ccactcccgc cacctgcctc aagatttctg 601 acatcatcta tctaaaagct gtgaacgtgc tgaacctcac tcgactgaca ttttttttct 661 tgattccttt gttcatcatg attgggtgct acttggtcat tattcataat ctccttcacg 721 gcaggacgtc TAAGCTGAAA CCCAAAGTCA AGGAGAAGTC CATAAGGATC ATCATCACGC 781 TGCTGGTGCA GGTGCTCGTC TGCTTTATGC CCTTCCACAT CTGTTTCGCT TTCCTGATGC 841 TGGGAACGGG GGAGAACAGT TACAATCCCT GGGGAGCCTT TACCACCTTC CTCATGAACC 901 TCAGCACGTG TCTGGATGTG ATTCTCTACT ACATCGTTTC AAAACAATTT CAGGCTCGAG 961 TCATTAGTGT CATGCTATAC CGTAATTACC TTCGAAGCAT GCGCAGAAAA AGTTTCCGAT 1021 CTGGTAGTCT ACGGTCACTA AGCAATATAA ACAGTGAAAT GTTATAGGAC CCAGCTTTCT 1081 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1141 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1201 GTGGAAAGGA CGACACTCGA ACGATTGCGG AGCGCACACG CGTTAAGTCg acaatcaacc 1261 tctggattac aaaatttgtg aaagatt