Construct: ORF TRCN0000488838
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020626.1_s317c1
- DNA Barcode:
- TAATATCATACATGAAACAATGTT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- SRC (6714)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488838
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | NM_005417.4 | 99.8% | 99.8% | 48C>T;1589A>T |
| 2 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | NM_198291.2 | 99.8% | 99.8% | 48C>T;1589A>T |
| 3 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_011529013.2 | 99.8% | 99.8% | 48C>T;1218G>C;1589A>T |
| 4 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028024.1 | 98.7% | 98.7% | (many diffs) |
| 5 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028025.1 | 98.7% | 98.7% | (many diffs) |
| 6 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028026.1 | 98.7% | 98.7% | (many diffs) |
| 7 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028027.2 | 98.7% | 98.7% | (many diffs) |
| 8 | mouse | 20779 | Src | Rous sarcoma oncogene | NM_001025395.2 | 89.9% | 98.6% | (many diffs) |
| 9 | mouse | 20779 | Src | Rous sarcoma oncogene | NM_009271.3 | 88.9% | 97.6% | (many diffs) |
| 10 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_006499063.3 | 87.1% | 95.6% | (many diffs) |
| 11 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_006499065.3 | 87.1% | 95.6% | (many diffs) |
| 12 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_006499066.2 | 87.1% | 95.6% | (many diffs) |
| 13 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_011239402.2 | 87.1% | 95.6% | (many diffs) |
| 14 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_011239403.2 | 87.1% | 95.6% | (many diffs) |
| 15 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_011239404.1 | 87.1% | 95.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1680
- ORF length:
- 1608
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggtagc aacaagagca agcccaagga tgccagccag cggcgccgta 121 gcctggagcc cgccgagaac gtgcacggcg ctggcggggg cgctttcccc gcctcgcaga 181 cccccagcaa gccagcctcg gccgacggcc accgcggccc cagcgcggcc ttcgcccccg 241 cggccgccga gcccaagctg ttcggaggct tcaactcctc ggacaccgtc acctccccgc 301 agagggcggg cccgctggcc ggtggagtga ccacctttgt ggccctctat gactatgagt 361 ctaggacgga gacagacctg tccttcaaga aaggcgagcg gctccagatt gtcaacaaca 421 cagagggaga ctggtggctg gcccactcgc tcagcacagg acagacaggc tacatcccca 481 gcaactacgt ggcgccctcc gactccatcc aggctgagga gtggtatttt ggcaagatca 541 ccagacggga gtcagagcgg ttactgctca atgcagagaa cccgagaggg accttcctcg 601 tgcgagaaag tgagaccacg aaaggtgcct actgcctctc agtgtctgac ttcgacaacg 661 ccaagggcct caacgtgaag cactacaaga tccgcaagct ggacagcggc ggcttctaca 721 tcacctcccg cacccagttc aacagcctgc agcagctggt ggcctactac tccaaacacg 781 ccgatggcct gtgccaccgc ctcaccaccg tgtgccccac gtccaagccg cagactcagg 841 gcctggccaa ggatgcctgg gagatccctc gggagtcgct gcggctggag gtcaagctgg 901 gccagggctg ctttggcgag gtgtggatgg ggacctggaa cggtaccacc agggtggcca 961 tcaaaaccct gaagcctggc acgatgtctc cagaggcctt cctgcaggag gcccaggtca 1021 tgaagaagct gaggcatgag aagctggtgc agttgtatgc tgtggtttca gaggagccca 1081 tttacatcgt cacggagtac atgagcaagg ggagtttgct ggactttctc aagggggaga 1141 caggcaagta cctgcggctg cctcagctgg tggacatggc tgctcagatc gcctcaggca 1201 tggcgtacgt ggagcggatg aactacgtcc accgggacct tcgtgcagcc aacatcctgg 1261 tgggagagaa cctggtgtgc aaagtggccg actttgggct ggctcggctc attgaagaca 1321 atgagtacac ggcgcggcaa ggtgccaaat tccccatcaa gtggacggct ccagaagctg 1381 ccctctatgg ccgcttcacc atcaagtcgg acgtgtggtc cTTCGGGATC CTGCTGACTG 1441 AGCTCACCAC AAAGGGACGG GTGCCCTACC CTGGGATGGT GAACCGCGAG GTGCTGGACC 1501 AGGTGGAGCG GGGCTACCGG ATGCCCTGCC CGCCGGAGTG TCCCGAGTCC CTGCACGACC 1561 TCATGTGCCA GTGCTGGCGG AAGGAGCCTG AGGAGCGGCC CACCTTCGAG TACCTGCAGG 1621 CCTTCCTGGA GGACTACTTC ACGTCCACCG AGCCCCAGTT CCAGCCCGGG GAGAACCTCT 1681 AGGACCCAGC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1741 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1801 GGCTTTATAT ATCTTGTGGA AAGGACGATA ATATCATACA TGAAACAATG TTACGCGTTA 1861 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt