Construct: ORF TRCN0000488889
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021336.1_s317c1
- DNA Barcode:
- CCGTATATAGCCTTACTGTTTGGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- FA2H (79152)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488889
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79152 | FA2H | fatty acid 2-hydroxylase | XM_011523319.2 | 95.7% | 95.8% | 1_36del;639C>T |
| 2 | human | 79152 | FA2H | fatty acid 2-hydroxylase | NM_024306.5 | 75.1% | 75.2% | 1_276del;879C>T |
| 3 | human | 79152 | FA2H | fatty acid 2-hydroxylase | XM_011523317.3 | 56.2% | 47.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 912
- ORF length:
- 840
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggagaac gagcctgtag cccttgagga aactcagaag acagatcctg 121 ctatggaacc acggttcaaa gtggtggatt gggacaagga cctggtggac tggcgaaagc 181 ctctcctgtg gcaggtgggc cacttgggag agaagtacga tgagtgggtt caccagccgg 241 tgaccaggcc catccgcctc ttccactcag acctcattga gggcctctct aagactgtct 301 ggtacagtgt ccccatcatc tgggtgcccc tggtgctgta tctcagctgg tcctactacc 361 gaacctttgc ccagggcaac gtccgactct tcacgtcatt tacaacagag tacacggtgg 421 cagtgcccaa gtccatgttc cccgggctct tcatgctggg gacattcctc tggagcctca 481 tcgagtacct catccaccgc ttcctgttcc acatgaagcc ccccagcgac agctattacc 541 tcatcatgct gcacttcgtc atgcacggcc agcaccacaa ggcacccTTC GACGGCTCCC 601 GCCTGGTCTT CCCCCCTGTG CCAGCCTCCC TGGTGATCGG CGTCTTCTAC TTGTGCATGC 661 AGCTCATCCT GCCTGAGGCA GTAGGGGGCA CTGTGTTTGC GGGGGGCCTC CTGGGCTACG 721 TCCTCTATGA CATGACCCAT TACTACCTGC ACTTTGGCTC GCCGCACAAG GGCTCCTACC 781 TGTACAGCCT GAAGGCCCAC CACGTCAAGC ACCACTTTGC ACATCAGAAG TCAGGATTTG 841 GTATCAGCAC TAAATTGTGG GATTACTGTT TCCACACCCT CACTCCAGAG AAACCCCACC 901 TGAAGACGCA GTAGAACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 961 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1021 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CCGTATATAG CCTTACTGTT 1081 TGGAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt