Construct: ORF TRCN0000488946
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019171.1_s317c1
- DNA Barcode:
- GGAGTTACGCAAGGCTCATTATTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GLP1R (2740)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488946
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | NM_002062.5 | 99.7% | 99.7% | (many diffs) |
| 2 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | XM_017010750.1 | 94% | 93.4% | (many diffs) |
| 3 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | XR_001743348.1 | 64% | (many diffs) | |
| 4 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | XM_017010751.1 | 56.1% | 53.5% | (many diffs) |
| 5 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | XR_001743347.1 | 42.5% | (many diffs) | |
| 6 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | XR_001743346.1 | 41.8% | (many diffs) | |
| 7 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | NR_136562.2 | 25.3% | (many diffs) | |
| 8 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | NR_136563.2 | 21.2% | (many diffs) | |
| 9 | mouse | 14652 | Glp1r | glucagon-like peptide 1 rec... | NM_021332.2 | 87.4% | 92.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1464
- ORF length:
- 1389
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggcc ggcgcccccg gcccgctgcg ccttgcgctg ctgctgctcg 121 ggatggtggg cagggccggc ccccgccccc agggtgccac tgtgtccctc tgggagacgg 181 tgcagaaatg gcgagaatac cgacgccagt gccagcgctc cctgactgag gatccacctc 241 ctgccacaga cttgttctgc aaccggacct tcgatgaata cgcctgctgg ccagatgggg 301 agccaggctc gttcgtgaat gtcagctgcc cctggtacct gccctgggcc agcagtgtgc 361 cgcagggcca cgtgtaccgg ttctgcacag ctgaaggcct ctggctgcag aaggacaact 421 ccagcctgcc ctggagggac ttgtcggagt gcgaggagtc caagcgaggg gagagaagct 481 ccccggagga gcagctcctg ttcctctaca tcatctacac ggtgggctac gcactctcct 541 tctctgctct ggttatcgcc tctgcgatcc tcctcggctt cagacacctg cactgcaccc 601 ggaactacat ccacctgaac ctgtttgcat ccttcatcct gcgagcattg tccgtcttca 661 tcaaggacgc agccctgaag tggatgtata gcacagccgc ccagcagcac cagtgggatg 721 ggctcctctc ctaccaggac tctctgagct gccgcctggt gtttctgctc atgcagtact 781 gtgtggcggc caattactac tggctcttgg tggagggcgt gtacctgtac acactgctgg 841 ccttctcggt cttctctgag caatggatct tcaggctcta cgtgagcata ggctggggtg 901 ttcccctgct gtttgttgtc ccctggggca ttgtcaagta cctctatgag gacgagggct 961 gctggaccag gaactccaac atgaactact ggctcattat ccggctgccc attctctttg 1021 ccattggggt gaacttcctc atctttgttc gggtcatctg catcgtggta tccaaactga 1081 aggccaatct catgtgcaag acagacatca aatgcagact tgccaagtcc acgctgacac 1141 tcatccccct gctggGGACT CATGAGGTCA TCTTTGCCTT TGTGATGGAC GAGCACGCCC 1201 GGGGGACCCT GCGCTTCATC AAGCTGTTTA CAGAGCTCTC CTTCACCTCC TTCCAGGGGC 1261 TGATGGTGGC CATCTTATAC TGCTTTGTCA ACAATGAGGT CCAGCTGGAA TTTCGGAAGA 1321 GCTGGGAGCG CTGGCGGCTT GAGCACTTGC ACATCCAGAG GGACAGCAGC ATGAAGCCCC 1381 TCAAGTGTCC CACCAGCAGC CTGAGCAGTG GAGCCACGGC GGGCAGCAGC ATGTACACAG 1441 CCACTTGCCA GGCCTCCTGC AGCGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1501 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1561 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG GAGTTACGCA 1621 AGGCTCATTA TTAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1681 att