Construct: ORF TRCN0000488979
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019167.1_s317c1
- DNA Barcode:
- ATCGTAACGGTCTGTGAGGTTTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KISS1R (84634)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488979
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84634 | KISS1R | KISS1 receptor | NM_032551.5 | 100% | 100% | |
| 2 | human | 84634 | KISS1R | KISS1 receptor | XM_017027382.1 | 56.7% | 44% | 503_504ins233;678_679ins283 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1269
- ORF length:
- 1194
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgcac accgtggcta cgtccggacc caacgcgtcc tggggggcac 121 cggccaacgc ctccggctgc ccgggctgtg gcgccaacgc ctcggacggc ccagtccctt 181 cgccgcgggc cgtggacgcc tggctcgtgc cgctcttctt cgcggcgctg atgctgctgg 241 gcctggtggg gaactcgctg gtcatctacg tcatctgccg ccacaagccg atgcggaccg 301 tgaccaactt ctacatcgcc aacctggcgg ccacggacgt gaccttcctc ctgtgctgcg 361 tccccttcac ggccctgctg tacccgctgc ccggctgggt gctgggcgac ttcatgtgca 421 agttcgtcaa ctacatccag caggtctcgg tgcaggccac gtgtgccact ctgaccgcca 481 tgagtgtgga ccgctggtac gtgacggtgt tcccgttgcg cgccctgcac cgccgcacgc 541 cccgcctggc gctggctgtc agcctcagca tctgggtagg ctctgcggcg gtgtctgcgc 601 cggtgctcgc cctgcaccgc ctgtcacccg ggccgcgcgc ctactgcagt gaggccttcc 661 ccagccgcgc cctggagcgc gccttcgcac tgtacaacct gctggcgctg tacctgctgc 721 cgctgctcgc cacctgcgcc tgctatgcgg ccatgctgcg ccacctgggc cgggtcgccg 781 tgcgccccgc gcccgccgat agcgccctgc aggggcaggt gctggcagag cgcgcaggcg 841 ccgtgcgggc caaggtctcg cggctggtgg cggccgtggt cctgctcttc gccgcctgct 901 ggggccccat ccagctgttc ctGGTGCTGC AGGCGCTGGG CCCCGCGGGC TCCTGGCACC 961 CACGCAGCTA CGCCGCCTAC GCGCTTAAGA CCTGGGCTCA CTGCATGTCC TACAGCAACT 1021 CCGCGCTGAA CCCGCTGCTC TACGCCTTCC TGGGCTCGCA CTTCCGACAG GCCTTCCGCC 1081 GCGTCTGCCC CTGCGCGCCG CGCCGCCCCC GCCGCCCCCG CCGGCCCGGA CCCTCGGACC 1141 CCGCAGCCCC ACACGCGGAG CTGCTCCGCC TGGGGTCCCA CCCGGCCCCC GCCAGGGCGC 1201 AGAAGCCAGG GAGCAGTGGG CTGGCCGCGC GCGGGCTGTG CGTCCTGGGG GAGGACAACG 1261 CCCCTCTCGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1321 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1381 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAATCGTA ACGGTCTGTG AGGTTTTTAC 1441 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt