Transcript: Human XM_017027382.1

PREDICTED: Homo sapiens KISS1 receptor (KISS1R), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KISS1R (84634)
Length:
1577
CDS:
811..1491

Additional Resources:

NCBI RefSeq record:
XM_017027382.1
NBCI Gene record:
KISS1R (84634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011607 GTGCAAGTTCGTCAACTACAT pLKO.1 1152 CDS 100% 4.950 6.930 N KISS1R n/a
2 TRCN0000011606 GACCAACTTCTACATCGCCAA pLKO.1 1038 CDS 100% 2.160 3.024 N KISS1R n/a
3 TRCN0000011609 GCGGACCGTGACCAACTTCTA pLKO.1 1029 CDS 100% 1.650 2.310 N KISS1R n/a
4 TRCN0000011608 CTACAGCAACTCCGCGCTGAA pLKO.1 1513 3UTR 100% 1.350 1.890 N KISS1R n/a
5 TRCN0000357293 CTCGCTGGTCATCTACGTCAT pLKO_005 990 CDS 100% 4.050 2.835 N KISS1R n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04405 pDONR223 100% 56.7% 44% None 503_504ins233;678_679ins283 n/a
2 TRCN0000476952 ACTACAGTCCAACGCATTTGATCA pLX_317 30.3% 56.7% 44% V5 503_504ins233;678_679ins283 n/a
3 TRCN0000488979 ATCGTAACGGTCTGTGAGGTTTTT pLX_317 29.1% 56.7% 44% V5 503_504ins233;678_679ins283 n/a
4 TRCN0000488032 AGTCTGTGCCGTGAGGCCCTTAAA pLX_317 24.9% 56.7% 44% V5 (not translated due to prior stop codon) 503_504ins233;678_679ins283 n/a
Download CSV