Construct: ORF TRCN0000489000
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020948.1_s317c1
- DNA Barcode:
- CGCGCACTGCCGGCACTTATGGGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GHSR (2693)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489000
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2693 | GHSR | growth hormone secretagogue... | NM_004122.2 | 100% | 100% | |
| 2 | human | 2693 | GHSR | growth hormone secretagogue... | NM_198407.2 | 77.2% | 71.7% | (many diffs) |
| 3 | mouse | 208188 | Ghsr | growth hormone secretagogue... | NM_177330.4 | 70.1% | 68% | (many diffs) |
| 4 | mouse | 208188 | Ghsr | growth hormone secretagogue... | XM_017319513.1 | 59.8% | 58.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 939
- ORF length:
- 867
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtggaac gcgacgccca gcgaagagcc ggggttcaac ctcacactgg 121 ccgacctgga ctgggatgct tcccccggca acgactcgct gggcgacgag ctgctgcagc 181 tcttccccgc gccgctgctg gcgggcgtca cagccacctg cgtggcactc ttcgtggtgg 241 gcatcgctgg caacctgctc accatgctgg tggtgtcgcg cttccgcgag ctgcgcacca 301 ccaccaacct ctacctgtcc agcatggcct tctccgatct gctcatcttc ctctgcatgc 361 ccctggacct cgttcgcctc tggcagtacc ggccctggaa cttcggcgac ctcctctgca 421 aactcttcca attcgtcagt gagagctgca cctacgccac ggtgctcacc atcacagcgc 481 tgagcgtcga gcgctacttc gccatctgct tcccactccg ggccaaggtg gtggtcacca 541 aggggcgggt gaagctggtc atcttcgtca tctgggccgt ggccTTCTGC AGCGCCGGGC 601 CCATCTTCGT GCTAGTCGGG GTGGAGCACG AGAACGGCAC CGACCCTTGG GACACCAACG 661 AGTGCCGCCC CACCGAGTTT GCGGTGCGCT CTGGACTGCT CACGGTCATG GTGTGGGTGT 721 CCAGCATCTT CTTCTTCCTT CCTGTCTTCT GTCTCACGGT CCTCTACAGT CTCATCGGCA 781 GGAAGCTGTG GCGGAGGAGG CGCGGCGATG CTGTCGTGGG TGCCTCGCTC AGGGACCAGA 841 ACCACAAGCA AACCGTGAAA ATGCTGGGTG GGTCTCAGCG CGCGCTCAGG CTTTCTCTCG 901 CGGGTCCTAT CCTCTCCCTG TGCCTTCTCC CTTCTCTCTA GAACCCAGCT TTCTTGTACA 961 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1021 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1081 AGGACGACGC GCACTGCCGG CACTTATGGG CACGCGTTAA GTCgacaatc aacctctgga 1141 ttacaaaatt tgtgaaagat t