Transcript: Mouse XM_017319513.1

PREDICTED: Mus musculus growth hormone secretagogue receptor (Ghsr), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ghsr (208188)
Length:
5884
CDS:
298..1581

Additional Resources:

NCBI RefSeq record:
XM_017319513.1
NBCI Gene record:
Ghsr (208188)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368671 TTCTCCGATCTGCTCATCTTC pLKO_005 742 CDS 100% 4.950 6.930 N GHSR n/a
2 TRCN0000028725 CCGTGTTCAAACTTCTAGGAT pLKO.1 1478 CDS 100% 3.000 4.200 N Ghsr n/a
3 TRCN0000028676 TGGACAAAGTCGAGCATCAAT pLKO.1 1555 CDS 100% 5.625 3.938 N Ghsr n/a
4 TRCN0000028712 CCACAAACAGACAGTGAAGAT pLKO.1 1251 CDS 100% 4.950 3.465 N Ghsr n/a
5 TRCN0000028733 GCAGATCAGTCAGTACTGCAA pLKO.1 1374 CDS 100% 2.640 1.848 N Ghsr n/a
6 TRCN0000028753 CTCTGCAAACTCTTCCAGTTT pLKO.1 826 CDS 100% 0.495 0.297 N Ghsr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06272 pDONR223 100% 76.3% 81.3% None (many diffs) n/a
2 ccsbBroad304_06272 pLX_304 0% 76.3% 81.3% V5 (many diffs) n/a
3 TRCN0000477762 ACAAGACATCAAGTACGGGCCTAT pLX_317 5% 76.3% 81.3% V5 (many diffs) n/a
4 TRCN0000489784 AAGCATTTGTCTGCCTTACTAACC pLX_317 36.4% 76.3% 81.3% V5 (many diffs) n/a
5 TRCN0000488175 GGTGTGACAAATGAAATGGTGGTG pLX_317 30.2% 76.3% 81.3% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489049 CAGCTCATACGTTCTCGATGAGCT pLX_317 40.7% 59.8% 58.6% V5 (many diffs) n/a
7 TRCN0000489000 CGCGCACTGCCGGCACTTATGGGC pLX_317 41% 59.8% 58.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV