Construct: ORF TRCN0000489020
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019546.1_s317c1
- DNA Barcode:
- GAGTATTACGAATGATACGACCCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- CXCR1 (3577)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489020
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3577 | CXCR1 | C-X-C motif chemokine recep... | NM_000634.3 | 99.6% | 100% | 1050_1051insTAGG |
| 2 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | NM_001168298.2 | 81.2% | 75.2% | (many diffs) |
| 3 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | NM_001557.4 | 81.2% | 75.2% | (many diffs) |
| 4 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_005246530.3 | 81.2% | 75.2% | (many diffs) |
| 5 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003990.1 | 81.2% | 75.2% | (many diffs) |
| 6 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003991.1 | 81.2% | 75.2% | (many diffs) |
| 7 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003992.1 | 81.2% | 75.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1125
- ORF length:
- 1050
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgtca aatattacag atccacagat gtgggatttt gatgatctaa 121 atttcactgg catgccacct gcagatgaag attacagccc ctgtatgcta gaaactgaga 181 cactcaacaa gtatgttgtg atcatcgcct atgccctagt gttcctgctg agcctgctgg 241 gaaactccct ggtgatgctg gtcatcttat acagcagggt cggccgctcc gtcactgatg 301 tctacctgct gaacctggcc ttggccgacc tactctttgc cctgaccttg cccatctggg 361 ccgcctccaa ggtgaatggc tggatttttg gcacattcct gtgcaaggtg gtctcactcc 421 tgaaggaagt caacttctac agtggcatcc tgctgttggc ctgcatcagt gtggaccgtt 481 acctggccat tgtccatgcc acacgcacac tgacccagaa gcgtcacttg gtcaagtttg 541 tttgtcttgg ctgctgggga ctgtctatga atctgtccct gcccttcttc cttttccgcc 601 aggcttacca tccaaacaat tccagtccag tttgctatga ggtcctggga aatgacacag 661 caaaatggcg gatggtgttg cggatcctgc ctcacacctt tggcttcatc gtgccgctgt 721 ttgtcatgct gttctgctat ggattcaccc tgcgtacact gtttaaggcc cacatggggc 781 agaagcaccg agccatgagg gtcatctttg ctgtcgtcct caTCTTCCTG CTTTGCTGGC 841 TGCCCTACAA CCTGGTCCTG CTGGCAGACA CCCTCATGAG GACCCAGGTG ATCCAGGAGA 901 GCTGTGAGCG CCGCAACAAC ATCGGCCGGG CCCTGGATGC CACTGAGATT CTGGGATTTC 961 TCCATAGCTG CCTCAACCCC ATCATCTACG CCTTCATCGG CCAAAATTTT CGCCATGGAT 1021 TCCTCAAGAT CCTGGCTATG CATGGCCTGG TCAGCAAGGA GTTCTTGGCA CGTCATCGTG 1081 TTACCTCCTA CACTTCTTCG TCTGTCAATG TCTCTTCCAA CCTCTAGGAC CCAGCTTTCT 1141 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1201 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1261 GTGGAAAGGA CGAGAGTATT ACGAATGATA CGACCCCACG CGTTAAGTCg acaatcaacc 1321 tctggattac aaaatttgtg aaagatt