Construct: ORF TRCN0000489091
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019932.1_s317c1
- DNA Barcode:
- ATCCCCTAACAAGTTCCGCCGTGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TPRA1 (131601)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489091
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 131601 | TPRA1 | transmembrane protein adipo... | NM_001142646.4 | 77.9% | 72.3% | (many diffs) |
| 2 | human | 131601 | TPRA1 | transmembrane protein adipo... | NM_001353006.2 | 68% | 52% | 496_566del;789_1053delinsG |
| 3 | human | 131601 | TPRA1 | transmembrane protein adipo... | NM_001136053.4 | 64% | 55% | 610_670del;779_1119delinsG |
| 4 | human | 131601 | TPRA1 | transmembrane protein adipo... | NM_001353001.2 | 64% | 55% | 610_670del;779_1119delinsG |
| 5 | human | 131601 | TPRA1 | transmembrane protein adipo... | NM_001353002.2 | 64% | 55% | 610_670del;779_1119delinsG |
| 6 | human | 131601 | TPRA1 | transmembrane protein adipo... | NM_001353003.2 | 64% | 55% | 610_670del;779_1119delinsG |
| 7 | human | 131601 | TPRA1 | transmembrane protein adipo... | NM_001353004.2 | 64% | 55% | 610_670del;779_1119delinsG |
| 8 | human | 131601 | TPRA1 | transmembrane protein adipo... | NM_001353005.2 | 64% | 55% | 610_670del;779_1119delinsG |
| 9 | human | 131601 | TPRA1 | transmembrane protein adipo... | XM_006713496.3 | 64% | 55% | 610_670del;779_1119delinsG |
| 10 | human | 131601 | TPRA1 | transmembrane protein adipo... | NM_001353007.2 | 60.3% | 50.5% | (many diffs) |
| 11 | human | 131601 | TPRA1 | transmembrane protein adipo... | XR_001740017.1 | 43.2% | 1_141del;859_1658delinsG | |
| 12 | human | 131601 | TPRA1 | transmembrane protein adipo... | XR_924102.2 | 39.9% | 1_277del;995_1794delinsG | |
| 13 | human | 131601 | TPRA1 | transmembrane protein adipo... | XR_001740016.2 | 34.6% | 1_552del;1270_2069delinsG | |
| 14 | human | 131601 | TPRA1 | transmembrane protein adipo... | NR_073377.3 | 19.4% | 1_341del;1059_3691delinsG | |
| 15 | human | 131601 | TPRA1 | transmembrane protein adipo... | NR_148226.2 | 18.7% | (many diffs) | |
| 16 | mouse | 24100 | Tpra1 | transmembrane protein, adip... | NM_011906.2 | 55.2% | 49.6% | (many diffs) |
| 17 | mouse | 24100 | Tpra1 | transmembrane protein, adip... | XM_006506061.2 | 55.2% | 49.6% | (many diffs) |
| 18 | mouse | 24100 | Tpra1 | transmembrane protein, adip... | XM_006506062.2 | 55.2% | 49.6% | (many diffs) |
| 19 | mouse | 24100 | Tpra1 | transmembrane protein, adip... | XM_006506063.2 | 55.2% | 49.6% | (many diffs) |
| 20 | mouse | 24100 | Tpra1 | transmembrane protein, adip... | XM_006506064.2 | 32.5% | 27.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 792
- ORF length:
- 720
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggacacc ctggaggagg tgacttgggc caatgggagc acagcgctac 121 ccccacccct ggcaccaaac atcagtgtgc ctcatcgctg cctgctgctg ctctacgaag 181 acattggcac ctccagggtc cggtactggg acctcttgct gctcatcccc aatgtgctct 241 tcctcatctt cctgctctgg aagcttccat ctgctcgggc gaagatccgc atcacctcca 301 gccccatttt tatcaccttc tacatcctgg tgtttgtggt ggcgctggtg ggcattgccc 361 gggccgtggt atccatgacg gtgagcacct cgaacgctgc aactgttgct gataagatcc 421 tgtgggagat cacccgcttc ttccTGCTGG CCATCGAGCT GAGTGTGATC ATCCTGGGCC 481 TGGCCTTTGG CCACCTGGAG AGTAAGTCCA GCATCAAGCG GGTGCTGGCC ATCACCACAG 541 TGCTGTCCCT GGCCTACTCT GTCACCCAGG GGACCCTGGA GATCCTGTAC CCTGATGCCC 601 ATCTCTCAGC TGAGGACTTT AATATCTATG GCCATGGGGG CCGCCAGTTC TGGCTGGTCA 661 GCTCCTGCTT CTTCTTCCTG CTCGGAGGAG CTTCTACGTG TATGCGGGCA TCCTGGCACT 721 GCTCAACCTA CTGCAGGGGC TGGGGAGTGT GCTGCTGTGC TTCGACATCA TCGAGGGGCT 781 CTGCTGTGGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 841 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 901 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAATCCCC TAACAAGTTC CGCCGTGAAC 961 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt