Transcript: Mouse XM_006506061.2

PREDICTED: Mus musculus transmembrane protein, adipocyte asscociated 1 (Tpra1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tpra1 (24100)
Length:
4245
CDS:
2851..3960

Additional Resources:

NCBI RefSeq record:
XM_006506061.2
NBCI Gene record:
Tpra1 (24100)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240727 ACCGCCCACAGCATCCAATAT pLKO_005 2892 CDS 100% 13.200 18.480 N Tpra1 n/a
2 TRCN0000240728 TGCTGCTATATGAGGATATTG pLKO_005 2936 CDS 100% 13.200 10.560 N Tpra1 n/a
3 TRCN0000217500 GTCTACTCACTGGTGGTAATT pLKO.1 3451 CDS 100% 13.200 9.240 N Tpra1 n/a
4 TRCN0000240730 TCTACTCACTGGTGGTAATTC pLKO_005 3452 CDS 100% 13.200 9.240 N Tpra1 n/a
5 TRCN0000193850 CATTCCCAATGTGCTCTTCTT pLKO.1 2994 CDS 100% 4.950 3.465 N Tpra1 n/a
6 TRCN0000193652 CTTCCTGTACTTCAGCTTCTT pLKO.1 3633 CDS 100% 4.950 3.465 N Tpra1 n/a
7 TRCN0000240729 TTTGCCTCCTGTGCTCTAGTG pLKO_005 4075 3UTR 100% 4.050 2.835 N Tpra1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491794 AACACATGTGGTTGTTCGATACAC pLX_317 29.8% 86% 91.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488756 ATACAAAATGAATTCATGAAGAAA pLX_317 17.2% 85.9% 91.1% V5 (many diffs) n/a
3 ccsbBroadEn_13163 pDONR223 100% 55.2% 50.6% None (many diffs) n/a
4 ccsbBroad304_13163 pLX_304 0% 55.2% 50.6% V5 (many diffs) n/a
5 TRCN0000469128 CTCGTGACATGCTAATCGGTAGAC pLX_317 50.2% 55.2% 50.6% V5 (many diffs) n/a
6 TRCN0000489091 ATCCCCTAACAAGTTCCGCCGTGA pLX_317 47.7% 55.2% 49.6% V5 (many diffs) n/a
7 TRCN0000489032 CAATTCCTTCTCTTTTTATTAAAC pLX_317 47.9% 55.2% 50.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV