Construct: ORF TRCN0000489150
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020863.1_s317c1
- DNA Barcode:
- CGCTATTTTGTTTTATTATAACAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- LPAR1 (1902)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489150
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351397.2 | 99.9% | 100% | 204A>G |
| 2 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351398.2 | 99.9% | 100% | 204A>G |
| 3 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351399.2 | 99.9% | 100% | 204A>G |
| 4 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351400.2 | 99.9% | 100% | 204A>G |
| 5 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351401.2 | 99.9% | 100% | 204A>G |
| 6 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351402.2 | 99.9% | 100% | 204A>G |
| 7 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351403.2 | 99.9% | 100% | 204A>G |
| 8 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351404.2 | 99.9% | 100% | 204A>G |
| 9 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351405.2 | 99.9% | 100% | 204A>G |
| 10 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351406.2 | 99.9% | 100% | 204A>G |
| 11 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351407.2 | 99.9% | 100% | 204A>G |
| 12 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351408.2 | 99.9% | 100% | 204A>G |
| 13 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351409.2 | 99.9% | 100% | 204A>G |
| 14 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351410.2 | 99.9% | 100% | 204A>G |
| 15 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351411.2 | 99.9% | 100% | 204A>G |
| 16 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351412.2 | 99.9% | 100% | 204A>G |
| 17 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351413.2 | 99.9% | 100% | 204A>G |
| 18 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351414.2 | 99.9% | 100% | 204A>G |
| 19 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351415.2 | 99.9% | 100% | 204A>G |
| 20 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351416.2 | 99.9% | 100% | 204A>G |
| 21 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351417.2 | 99.9% | 100% | 204A>G |
| 22 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351418.2 | 99.9% | 100% | 204A>G |
| 23 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351419.1 | 99.9% | 100% | 204A>G |
| 24 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001351420.1 | 99.9% | 100% | 204A>G |
| 25 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_001401.5 | 99.9% | 100% | 204A>G |
| 26 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | NM_057159.4 | 99.9% | 100% | 204A>G |
| 27 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | XM_005251782.3 | 99.9% | 100% | 204A>G |
| 28 | human | 1902 | LPAR1 | lysophosphatidic acid recep... | XM_017014404.2 | 99.9% | 100% | 204A>G |
| 29 | mouse | 14745 | Lpar1 | lysophosphatidic acid recep... | NM_010336.2 | 90.4% | 97.2% | (many diffs) |
| 30 | mouse | 14745 | Lpar1 | lysophosphatidic acid recep... | NM_172989.1 | 90.4% | 97.2% | (many diffs) |
| 31 | mouse | 14745 | Lpar1 | lysophosphatidic acid recep... | XM_011249928.2 | 90.4% | 97.2% | (many diffs) |
| 32 | mouse | 14745 | Lpar1 | lysophosphatidic acid recep... | XM_011249929.2 | 90.4% | 97.2% | (many diffs) |
| 33 | mouse | 14745 | Lpar1 | lysophosphatidic acid recep... | XM_011249930.2 | 90.4% | 97.2% | (many diffs) |
| 34 | mouse | 14745 | Lpar1 | lysophosphatidic acid recep... | XM_011249931.2 | 90.4% | 97.2% | (many diffs) |
| 35 | mouse | 14745 | Lpar1 | lysophosphatidic acid recep... | XM_011249932.2 | 90.4% | 97.2% | (many diffs) |
| 36 | mouse | 14745 | Lpar1 | lysophosphatidic acid recep... | XM_011249933.2 | 90.4% | 97.2% | (many diffs) |
| 37 | mouse | 14745 | Lpar1 | lysophosphatidic acid recep... | XM_011249934.2 | 90.4% | 97.2% | (many diffs) |
| 38 | mouse | 14745 | Lpar1 | lysophosphatidic acid recep... | XM_011249935.2 | 90.4% | 97.2% | (many diffs) |
| 39 | mouse | 14745 | Lpar1 | lysophosphatidic acid recep... | NM_001290486.1 | 85.9% | 92.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1164
- ORF length:
- 1092
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggctgcc atctctactt ccatccctgt aatttcacag ccccagttca 121 cagccatgaa tgaaccacag tgcttctaca acgagtccat tgccttcttt tataaccgaa 181 gtggaaagca tcttgccaca gaatggaaca cagtcagcaa gctggtgatg ggacttggaa 241 tcactgtttg tatcttcatc atgttggcca acctgttggt catggtggca atctatgtca 301 accgccgctt ccattttcct atttattacc taatggctaa tctggctgct gcagacttct 361 ttgctgggtt ggcctacttc tatctcatgt tcaacacagg acccaatact cggagactga 421 ctgttagcac atggctcctt cgtcagggcc tcattgacac cagcctgacg gcatctgtgg 481 ccaacttact ggctattgca atcgagaggc acattacggt tttccgcatg cagctccaca 541 cacggatgag caaccggcgg gtagtggtgg tcattgtggt catctggact atggccatcg 601 ttatgggtgc tatacccagt gtgggctgga actgtatctg tgatattgaa aattgttcca 661 acatggcacc cctctacagt gactcttact tagtcttctg ggccattttc aacttggtga 721 cctttgtggt aatggtggtt ctctatgctc acatctttGG CTATGTTCGC CAGAGGACTA 781 TGAGAATGTC TCGGCATAGT TCTGGACCCC GGCGGAATCG GGATACCATG ATGAGTCTTC 841 TGAAGACTGT GGTCATTGTG CTTGGGGCCT TTATCATCTG CTGGACTCCT GGATTGGTTT 901 TGTTACTTCT AGACGTGTGC TGTCCACAGT GCGACGTGCT GGCCTATGAG AAATTCTTCC 961 TTCTCCTTGC TGAATTCAAC TCTGCCATGA ACCCCATCAT TTACTCCTAC CGCGACAAAG 1021 AAATGAGCGC CACCTTTAGG CAGATCCTCT GCTGCCAGCG CAGTGAGAAC CCCACCGGCC 1081 CCACAGAAGG CTCAGACCGC TCGGCTTCCT CCCTCAACCA CACCATCTTG GCTGGAGTTC 1141 ACAGCAATGA CCACTCTGTG GTTTAGGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1201 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1261 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACGCTATTT 1321 TGTTTTATTA TAACACACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1381 aagatt