Transcript: Mouse XM_011249934.2

PREDICTED: Mus musculus lysophosphatidic acid receptor 1 (Lpar1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lpar1 (14745)
Length:
3255
CDS:
278..1372

Additional Resources:

NCBI RefSeq record:
XM_011249934.2
NBCI Gene record:
Lpar1 (14745)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222329 GCCAGTATCATTGATGATTTA pLKO.1 2617 3UTR 100% 13.200 18.480 N Lpar1 n/a
2 TRCN0000222330 GCCGCTTCCATTTCCCTATTT pLKO.1 510 CDS 100% 13.200 18.480 N Lpar1 n/a
3 TRCN0000327981 GCCGCTTCCATTTCCCTATTT pLKO_005 510 CDS 100% 13.200 18.480 N Lpar1 n/a
4 TRCN0000328055 TCTACTCCTACCGCGACAAAG pLKO_005 1206 CDS 100% 10.800 15.120 N Lpar1 n/a
5 TRCN0000328054 TGTTCAATACAGGACCTAATA pLKO_005 594 CDS 100% 13.200 10.560 N Lpar1 n/a
6 TRCN0000222331 CGAGTTCAACTCTGCTATGAA pLKO.1 1177 CDS 100% 5.625 4.500 N Lpar1 n/a
7 TRCN0000327982 AGAGACTTGAGGATGAATTTA pLKO_005 1509 3UTR 100% 15.000 10.500 N Lpar1 n/a
8 TRCN0000328056 AGCGCAACGAGAACCCTAATG pLKO_005 1263 CDS 100% 10.800 7.560 N Lpar1 n/a
9 TRCN0000222333 CATCACTGTTTGCGTGTTCAT pLKO.1 445 CDS 100% 4.950 3.465 N Lpar1 n/a
10 TRCN0000222332 CCTTCTGAAGACTGTGGTCAT pLKO.1 1042 CDS 100% 4.050 2.835 N Lpar1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00477 pDONR223 100% 90.4% 97.2% None (many diffs) n/a
2 ccsbBroad304_00477 pLX_304 0% 90.4% 97.2% V5 (many diffs) n/a
3 TRCN0000489150 CGCTATTTTGTTTTATTATAACAC pLX_317 37.3% 90.4% 97.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488237 CAATGTATCCTACCGGCAATACTT pLX_317 27.6% 90.3% 96.9% V5 (many diffs) n/a
5 ccsbBroadEn_10795 pDONR223 100% 85.9% 92.8% None (many diffs) n/a
6 ccsbBroad304_10795 pLX_304 0% 85.9% 92.8% V5 (many diffs) n/a
Download CSV