Construct: ORF TRCN0000489192
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019248.1_s317c1
- DNA Barcode:
- CAGACTCAAGACCTCGCGACTGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR68 (8111)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489192
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_005268110.4 | 100% | 100% | |
| 2 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_005268111.3 | 100% | 100% | |
| 3 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_005268112.3 | 100% | 100% | |
| 4 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_006720262.3 | 100% | 100% | |
| 5 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537196.2 | 100% | 100% | |
| 6 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537197.3 | 100% | 100% | |
| 7 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537198.2 | 100% | 100% | |
| 8 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537199.2 | 100% | 100% | |
| 9 | human | 8111 | GPR68 | G protein-coupled receptor 68 | NM_001177676.2 | 97.3% | 97.3% | 0_1ins30 |
| 10 | human | 8111 | GPR68 | G protein-coupled receptor 68 | NM_001348437.1 | 97.3% | 97.3% | 0_1ins30 |
| 11 | human | 8111 | GPR68 | G protein-coupled receptor 68 | NM_003485.3 | 97.3% | 97.3% | 0_1ins30 |
| 12 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | XM_017315062.1 | 87.6% | 91.7% | (many diffs) |
| 13 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | NM_001177673.1 | 85.4% | 89.6% | (many diffs) |
| 14 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | NM_001177674.1 | 85.4% | 89.6% | (many diffs) |
| 15 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | NM_175493.4 | 85.4% | 89.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1200
- ORF length:
- 1125
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgagg agtgtggccc cttcaggccc aaagatgggg aacatcactg 121 cagacaactc ctcgatgagc tgtaccatcg accataccat ccaccagacg ctggccccgg 181 tggtctatgt taccgtgctg gtggtgggct tcccggccaa ctgcctgtcc ctctacttcg 241 gctacctgca gatcaaggcc cggaacgagc tgggcgtgta cctgtgcaac ctgacggtgg 301 ccgacctctt ctacatctgc tcgctgccct tctggctgca gtacgtgctg cagcacgaca 361 actggtctca cggcgacctg tcctgccagg tgtgcggcat cctcctgtac gagaacatct 421 acatcagcgt gggcttcctc tgctgcatct ccgtggaccg ctacctggct gtggcccatc 481 ccttccgctt ccaccagttc cggaccctga aggcggccgt cggcgtcagc gtggtcatct 541 gggccaagga gctgctgacc agcatctact tcctgatgca cgaggaggtc atcgaggacg 601 agaaccagca ccgcgtgtgc tttgagcact accccatcca ggcatggcag cgcgccatca 661 actactaccg cttcctggtg ggcttcctct tccccatctg cctgctgctg gcgtcctacc 721 agggcatcct gcgcgccgtg cgccggagcc acggcaccca gaagagccgc aaggaccaga 781 tccagcggct ggtgctcagc accgtggtca tcttcctggc ctgcttcctg cccTACCACG 841 TGTTGCTGCT GGTGCGCAGC GTCTGGGAGG CCAGCTGCGA CTTCGCCAAG GGCGTTTTCA 901 ACGCCTACCA CTTCTCCCTC CTGCTCACCA GCTTCAACTG CGTCGCCGAC CCCGTGCTCT 961 ACTGCTTCGT CAGCGAGACC ACCCACCGGG ACCTGGCCCG CCTCCGCGGG GCCTGCCTGG 1021 CCTTCCTCAC CTGCTCCAGG ACCGGCCGGG CCAGGGAGGC CTACCCGCTG GGTGCCCCCG 1081 AGGCCTCCGG GAAAAGCGGG GCCCAGGGTG AGGAGCCCGA GCTGTTGACC AAGCTCCACC 1141 CGGCCTTCCA GACCCCTAAC TCGCCAGGGT CGGGCGGGTT CCCCACGGGC AGGTTGGCCG 1201 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1261 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1321 TTTATATATC TTGTGGAAAG GACGACAGAC TCAAGACCTC GCGACTGTTA CGCGTTAAGT 1381 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt