Construct: ORF TRCN0000489249
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019216.1_s317c1
- DNA Barcode:
- CCGCACTCCATTGCACTACACTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TAS2R43 (259289)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489249
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 259289 | TAS2R43 | taste 2 receptor member 43 | NM_176884.2 | 99.6% | 99.3% | 104G>C;635A>G;663C>G |
| 2 | human | 259290 | TAS2R31 | taste 2 receptor member 31 | NM_176885.2 | 94.3% | 88.9% | (many diffs) |
| 3 | human | 259292 | TAS2R46 | taste 2 receptor member 46 | NM_176887.2 | 93% | 87.3% | (many diffs) |
| 4 | human | 259291 | TAS2R45 | taste 2 receptor member 45 | NM_176886.2 | 89.3% | 82.5% | (many diffs) |
| 5 | human | 259289 | TAS2R43 | taste 2 receptor member 43 | XM_003960991.5 | 89.3% | 82.5% | (many diffs) |
| 6 | human | 259293 | TAS2R30 | taste 2 receptor member 30 | NM_001097643.1 | 88.6% | 77.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1002
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgata acttttctac ccatcatttt ttccagtctg gtagtggtta 121 catttgttat tggaaatttt gctaatggct tcatagcact ggtaaattcc attgagtcgt 181 tcaagagaca aaagatctcc tttgctgacc aaattctcac tgctctggcg gtctccagag 241 ttggtttgct ctgggtatta ttattaaact ggtattcaac tgtgttgaat ccagctttta 301 atagtgtaga agtaagaact actgcttata atatctgggc agtgatcaac catttcagca 361 actggcttgc tactaccctc agcatatttt atttgctcaa gattgccaat ttctccaact 421 ttatttttct tcacttaaag aggagagtta agagtgtcat tctggtgatg ttgttggggc 481 ctttgctatt tttggcttgt catctttttg tgataaacat gaatgagatt gtgcggacaa 541 aagaatttga aggaaacatg acttggaaga tcaaattgaa gagtgcaatg tacttttcaa 601 atatgactgt aaccatggta gcaaacttag tacccttcac tctgacccTA CTATCTTTTA 661 TGCTGTTAAT CTGTTCTTTG TGTAAACATC TCAAGAAGAT GCAGCTCCGT GGTAAAGGAT 721 CTCAAGATCC CAGCACGAAG GTCCACATAA AAGCTTTGCA AACTGTGATC TCCTTCCTCT 781 TGTTATGTGC CATTTACTTT CTGTCCATAA TGATATCAGT TTGGAGTTTT GGAAGTCTGG 841 AAAACAAACC TGTCTTCATG TTCTGCAAAG CTATTAGATT CAGCTATCCT TCAATCCACC 901 CATTCATCCT GATTTGGGGA AACAAGAAGC TAAAGCAGAC TTTTCTTTCA GTTTTTTGGC 961 AAATGAGGTA CTGGGTGAAA GGAGAGAAGA CTTCATCTCC AGACCCAGCT TTCTTGTACA 1021 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1081 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1141 AGGACGACCG CACTCCATTG CACTACACTA GACGCGTTAA GTCgacaatc aacctctgga 1201 ttacaaaatt tgtgaaagat t