Construct: ORF TRCN0000489254
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019944.1_s317c1
- DNA Barcode:
- TACTCCATTGGTGGTGTAACATCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NR4A1 (3164)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489254
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3164 | NR4A1 | nuclear receptor subfamily ... | NM_002135.4 | 51.4% | 48.3% | (many diffs) |
| 2 | human | 3164 | NR4A1 | nuclear receptor subfamily ... | NM_173157.3 | 51.4% | 48.3% | (many diffs) |
| 3 | human | 3164 | NR4A1 | nuclear receptor subfamily ... | XM_005268824.3 | 51.4% | 48.3% | (many diffs) |
| 4 | human | 3164 | NR4A1 | nuclear receptor subfamily ... | XM_006719363.1 | 51.4% | 48.3% | (many diffs) |
| 5 | human | 3164 | NR4A1 | nuclear receptor subfamily ... | XM_006719364.4 | 51.4% | 48.3% | (many diffs) |
| 6 | human | 3164 | NR4A1 | nuclear receptor subfamily ... | XM_017019247.1 | 51.1% | 48% | (many diffs) |
| 7 | human | 3164 | NR4A1 | nuclear receptor subfamily ... | NM_001202233.1 | 50.3% | 47.3% | (many diffs) |
| 8 | human | 3164 | NR4A1 | nuclear receptor subfamily ... | NM_001202234.1 | 47.2% | 44.4% | (many diffs) |
| 9 | human | 3164 | NR4A1 | nuclear receptor subfamily ... | XM_005268822.3 | 45.9% | 43.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1050
- ORF length:
- 978
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgccctgt atccaagccc aatatgggac accagcaccg agtccgggac 121 cccgtgacca cctggcaagc gaccccctga cccctgagtt catcaagccc accatggacc 181 tggccagccc cgaggcagcc cccgctgccc ccactgccct gcccagcttc agcaccttca 241 tggacggcta cacaggagag tttgacacct tcctctacca gctgccagga acagtccagc 301 catgctcctc agcctcctcc tcggcctcct ccacatcctc gtcctcagcc acctcccctg 361 cctctgcctc cttcaagttc gaggacttcc aggtgtacgg ctgctacccc ggccccctga 421 gcggcccagt ggatgaggcc ctgtcctcca gtggctctga ctactatggc agcccctgct 481 cggccccgtc gccctccacg cccagcttcc agccgcccca gctctctccc tgggatggct 541 ccttcggcca cttctcgccc agccagactt acgaaggcct gcgggcatgg acagagcagc 601 tgcccaaagc ctctgggccc ccacagcctc cagccttctt ttccttcagt cctcccaccg 661 gccccagccc cagcctggcc cagagccccc tgaagttgtt cccctcacag gccacccacc 721 agctggggga gggagagagc tattccatgc ctacggcctt cccaggtttg gcacccactt 781 ctccacacct tgagggctcg gggatactgg atacacccgt gaccTCAACC AAGGCCCGGA 841 GCGGGGCCCC AGGTGGAAGT GAAGGCCGCT GTGCTGTGTG TGGGGACAAC GCTTCATGCC 901 AGCATTATGG TGTCCGCACA TGTGAGGGCT GCAAGGGCTT CTTCAAGGTA CCGCGCAGCC 961 CCAGGTGGGG CCTTTTGTTG GAAATGGAGA GAGGCTGGCC TCATCCCATT GGGACCTGTG 1021 GTCTCCCCCT GGGTTCTCCT CCTAGCGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1081 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1141 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATACTCCAT 1201 TGGTGGTGTA ACATCCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1261 aagatt