Transcript: Human NM_002135.4

Homo sapiens nuclear receptor subfamily 4 group A member 1 (NR4A1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
NR4A1 (3164)
Length:
2692
CDS:
320..2116

Additional Resources:

NCBI RefSeq record:
NM_002135.4
NBCI Gene record:
NR4A1 (3164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002135.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413984 CAACGCTTCATGCCAGCATTA pLKO_005 1135 CDS 100% 10.800 15.120 N NR4A1 n/a
2 TRCN0000427960 GTACATCTGCCTGGCTAACAA pLKO_005 1219 CDS 100% 5.625 4.500 N NR4A1 n/a
3 TRCN0000425334 TCCTTCCACATGTACATAAAC pLKO_005 2524 3UTR 100% 13.200 9.240 N NR4A1 n/a
4 TRCN0000415218 GTCACGTCTGTTGGGCAAACT pLKO_005 1975 CDS 100% 4.950 3.465 N NR4A1 n/a
5 TRCN0000019425 CTCCTTCAAGTTCGAGGACTT pLKO.1 616 CDS 100% 4.050 2.835 N NR4A1 n/a
6 TRCN0000420599 GCCAAACTGGACTACTCCAAG pLKO_005 1457 CDS 100% 4.050 2.835 N NR4A1 n/a
7 TRCN0000019428 GCTACACAGGAGAGTTTGACA pLKO.1 495 CDS 100% 3.000 2.100 N NR4A1 n/a
8 TRCN0000019427 TGGTGAAGGAAGTTGTCCGAA pLKO.1 1314 CDS 100% 2.640 1.848 N NR4A1 n/a
9 TRCN0000019426 GATTGACAGTATCCTGGCCTT pLKO.1 1765 CDS 100% 2.160 1.512 N NR4A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002135.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00760 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00760 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467273 TGACCCAGGTAACATAAACGCCTC pLX_317 22.6% 100% 100% V5 n/a
4 TRCN0000488428 TTGGTAAACACACCCTTTCCCTCT pLX_317 25.9% 53% 48.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489254 TACTCCATTGGTGGTGTAACATCC pLX_317 23.2% 51.4% 48.3% V5 (many diffs) n/a
Download CSV