Construct: ORF TRCN0000489288
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019292.1_s317c1
- DNA Barcode:
- ACCTGCATTTAATCACACTCAAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ADGRE2 (30817)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489288
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | NM_013447.4 | 99.6% | 99.5% | (many diffs) |
| 2 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XM_011527948.2 | 97.8% | 97.6% | (many diffs) |
| 3 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XM_011527949.2 | 96.5% | 96.2% | (many diffs) |
| 4 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XM_017026726.1 | 93.1% | 92.9% | (many diffs) |
| 5 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | NM_001271052.1 | 92.6% | 92.4% | (many diffs) |
| 6 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XM_011527951.3 | 92% | 91.7% | (many diffs) |
| 7 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XM_011527952.3 | 90.9% | 90.6% | (many diffs) |
| 8 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XM_011527953.2 | 87% | 86.8% | (many diffs) |
| 9 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XM_011527954.3 | 83.7% | 83.5% | (many diffs) |
| 10 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XM_017026727.1 | 83.7% | 83.5% | (many diffs) |
| 11 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XM_011527955.2 | 73.2% | 73.1% | (many diffs) |
| 12 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XR_001753674.1 | 36.7% | (many diffs) | |
| 13 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XR_001753675.1 | 34.3% | (many diffs) | |
| 14 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XR_936173.1 | 33.8% | (many diffs) | |
| 15 | human | 30817 | ADGRE2 | adhesion G protein-coupled ... | XR_936174.1 | 31.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 2544
- ORF length:
- 2469
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggga ggccgcgtct ttctcgtctt tctcgcattc tgtgtctggc 121 tgactctgcc gggagctgaa acccaggact ccaggggctg tgcccggtgg tgccctcagg 181 actcctcgtg tgtcaatgcc accgcctgtc gctgcaatcc agggttcagc tctttttctg 241 agatcatcac cacccccatg gagacttgtg acgacatcaa cgagtgtgca acactgtcga 301 aagtgtcatg cggaaaattc tcggactgct ggaacacaga ggggagctac gactgcgtgt 361 gcagcccagg atatgagcct gtttctgggg caaaaacatt caagaatgag agcgagaaca 421 cgtgtcaaga tgtggacgaa tgtcagcaga acccaaggct ctgtaaaagc tacggcacct 481 gcgtcaacac ccttggcagc tatacctgcc agtgcctgcc tggcttcaag ttcatacctg 541 aggatccgaa ggtctgcaca gatgtgaatg aatgcacctc cggacaaaac ccatgccaca 601 gctccaccca ctgcctcaac aacgtgggca gctatcagtg ccgctgccgc ccgggctggc 661 aaccgattcc ggggtccccc aatggcccaa acaataccgt ctgtgaagat gtggacgagt 721 gcagctccgg gcagcatcag tgtgacagct ccaccgtctg cttcaacacc gtgggttcat 781 acagctgccg ctgccgccca ggctggaagc ccagacacgg aatcccgaat aaccaaaagg 841 acactgtctg tgaagatatg actttctcca cctggacccc gccccctgga gtccacagcc 901 agacgctttc ccgattcttc gacaaagtcc aggacctggg cagagactac aagccaggct 961 tggccaataa caccatccag agcatcttac aggcgctgga tgagctgctg gaggtccctg 1021 gggacctgga gaccctgccc cgcttacagc agcactgtgt ggccagtcac ctgctggatg 1081 gcctagagga tgtcctcaga ggcctgagca agaacctttc caatgggctg ttgaacttca 1141 gttatcctgc aggcacagaa ttgtccctgg aggtgcagaa gcaagtagac aggagtgtca 1201 ccttgagaca gaatcaggca gtgatgcagc tcgactggaa tcaggcacag aaatctggtg 1261 acccaggccc ttctgtggtg ggccttgtct ccattccagg gatgggcaag ttgctggctg 1321 aggcccctct ggtcctggaa cctgagaagc agatgcttct gcatgagaca caccagggct 1381 tgctgcagga cggctccccc atcctgctct cagatgtgat ctctgccttt ctgagcaaca 1441 acgacaccca aaacctcagc tccccagtta ccttcacctt ctcccaccgt tcagtgatcc 1501 cgagacagaa ggtgctctgt gtcttctggg agcatggcca gaatggatgt ggtcactggg 1561 ccaccacagg ctgcagcaca ataggcacca gagacaccag caccatctgc cgttgcaccc 1621 acctgagcag ctttgccgtc ctcatggccc actacgatgt gcaggaggag gatcccgtgc 1681 tgactgtcat cacctacatg gggctgagcg tctctctgct gtgcctcctc ctggcggccc 1741 tcacttttct cctgtgtaaa gccatccaga acaccagcac ctcactgcat ctgcagctct 1801 cgctctgcct cttcctggcc cacctcctct tcctcgtggc aattgatcaa accggacaca 1861 aggtgctgtg ctccatcatc gccggtacct tgcactatct ctacctggcc accttgacct 1921 ggatgctgct ggaggccctg tacctcttcc tcactgcacg gaacctgacg gtggtcaact 1981 actcaagcat caacagattc atgaagaagc tcatgttccc tgtgggctac ggagtcccag 2041 ctgtgacagt ggccatttct gcagcctcca ggcctcacct ttatggaaca ccttcccgct 2101 gctggctcca accagaaaag ggatttatat ggggcttcct tggacctgtc tgcgccatcT 2161 TCTCTGTGAA TTTAGTTCTC TTTCTGGTGA CTCTCTGGAT TTTGAAAAAC AGACTCTCCT 2221 CCCTCAATAG TGAAGTGTCC ACCCTCCGGA ACACAAGGAT GCTGGCATTT AAAGCGACAG 2281 CTCAGCTGTT CATCCTGGGC TGCACGTGGT GTCTGGGCAT CTTGCAGGTG GGTCCGGCTG 2341 CCCGGGTCAT GGCCTACCTC TTCACCATCA TCAACAGCCT GCAGGGTGTC TTCATCTTCC 2401 TGGTGTACTG CCTCCTCAGC CAGCAGGTCC GGGAGCAATA TGGGAAATGG TCCAAAGGGA 2461 TCAGGAAATT GAAAACTGAG TCTGAGATGC ACACACTCTC CAGCAGTGCT AAGGCTGACA 2521 CCTCCAAACC CAGCACGGTT AACGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 2581 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 2641 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CCTGCATTTA 2701 ATCACACTCA AAGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 2761 att