Transcript: Human XM_011527951.3

PREDICTED: Homo sapiens adhesion G protein-coupled receptor E2 (ADGRE2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRE2 (30817)
Length:
2564
CDS:
86..2452

Additional Resources:

NCBI RefSeq record:
XM_011527951.3
NBCI Gene record:
ADGRE2 (30817)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378130 GGGCTGTTGAACTTCAGTTAT pLKO_005 989 CDS 100% 13.200 18.480 N ADGRE2 n/a
2 TRCN0000356967 CCTCGTGGCAATTGATCAAAC pLKO_005 1696 CDS 100% 10.800 15.120 N ADGRE2 n/a
3 TRCN0000356966 CAAGCCAGGCTTGGCCAATAA pLKO_005 814 CDS 100% 13.200 9.240 N ADGRE2 n/a
4 TRCN0000356969 CAGACTCTCCTCCCTCAATAG pLKO_005 2074 CDS 100% 10.800 7.560 N ADGRE2 n/a
5 TRCN0000221169 CCTGAGCAAGAACCTTTCCAA pLKO.1 967 CDS 100% 3.000 2.100 N ADGRE2 n/a
6 TRCN0000221168 CGCCATCTTCTCTGTGAATTT pLKO.1 2017 CDS 100% 13.200 7.920 N ADGRE2 n/a
7 TRCN0000221167 CGTGTCAAGATGTGGACGAAT pLKO.1 432 CDS 100% 4.950 2.970 N ADGRE2 n/a
8 TRCN0000221170 GCTGACTGTCATCACCTACAT pLKO.1 1543 CDS 100% 4.950 2.475 Y ADGRE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489288 ACCTGCATTTAATCACACTCAAAG pLX_317 15.8% 92% 91.7% V5 (many diffs) n/a
2 TRCN0000487838 GAACCAGCCGAACGTAAACCGATG pLX_317 12.5% 92% 91.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV