Construct: ORF TRCN0000489339
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019659.1_s317c1
- DNA Barcode:
- TAGATTACTAGTCTCCAAAAACCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SCTR (6344)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489339
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6344 | SCTR | secretin receptor | NM_002980.2 | 99.7% | 99.5% | 652G>A;1176T>C;1320_1321insG |
| 2 | human | 6344 | SCTR | secretin receptor | XM_011511621.2 | 98.6% | 98.4% | (many diffs) |
| 3 | human | 6344 | SCTR | secretin receptor | XM_017004670.1 | 94.7% | 93.4% | (many diffs) |
| 4 | human | 6344 | SCTR | secretin receptor | XM_017004671.1 | 90.5% | 90.3% | (many diffs) |
| 5 | human | 6344 | SCTR | secretin receptor | XM_024453038.1 | 84.3% | 84.1% | (many diffs) |
| 6 | human | 6344 | SCTR | secretin receptor | XM_017004672.1 | 83.3% | 83.1% | (many diffs) |
| 7 | human | 6344 | SCTR | secretin receptor | XR_922984.2 | 66.7% | (many diffs) | |
| 8 | human | 6344 | SCTR | secretin receptor | XR_001738887.1 | 62.6% | (many diffs) | |
| 9 | human | 6344 | SCTR | secretin receptor | XR_001738889.1 | 60.2% | (many diffs) | |
| 10 | human | 6344 | SCTR | secretin receptor | XM_005263730.5 | 59.3% | 59.1% | (many diffs) |
| 11 | human | 6344 | SCTR | secretin receptor | XM_017004673.1 | 58.6% | 58.5% | (many diffs) |
| 12 | human | 6344 | SCTR | secretin receptor | XR_001738888.1 | 54% | (many diffs) | |
| 13 | mouse | 319229 | Sctr | secretin receptor | XM_006529688.3 | 70.3% | 69.1% | (many diffs) |
| 14 | mouse | 319229 | Sctr | secretin receptor | XM_011248029.1 | 70.3% | 69.1% | (many diffs) |
| 15 | mouse | 319229 | Sctr | secretin receptor | XM_011248030.2 | 70.3% | 69.1% | (many diffs) |
| 16 | mouse | 319229 | Sctr | secretin receptor | XM_011248031.2 | 66.6% | 65.7% | (many diffs) |
| 17 | mouse | 319229 | Sctr | secretin receptor | XM_006529689.3 | 58.5% | 54.8% | (many diffs) |
| 18 | mouse | 319229 | Sctr | secretin receptor | XM_006529690.3 | 42.8% | 42.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1398
- ORF length:
- 1323
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgcgt ccccacctgt cgccgccgct gcagcagcta ctactgccgg 121 tgctgctcgc ctgcgccgcg cactcgactg gagcccttcc ccgactatgt gacgtgctac 181 aagtgctgtg ggaagagcaa gaccagtgcc tgcaggaact ctccagagag cagacaggag 241 acctgggcac ggagcagcca gtgccaggtt gtgaggggat gtgggacaac ataagctgct 301 ggccctcttc tgtgccgggc cggatggtgg aggtggaatg cccgagattc ctccggatgc 361 tcaccagcag aaatggttcc ttgttccgaa actgcacaca ggatggctgg tcagaaacct 421 tccccaggcc taatctggcc tgtggcgtta atgtgaacga ctcttccaac gagaagcggc 481 actcctacct gctgaagctg aaagtcatgt acaccgtggg ctacagctcc tccctggtca 541 tgctcctggt cgcccttggc atcctctgtg ctttccggag gctccactgc actcgcaact 601 acatccacat gcacctgttc gtgtccttca tccttcgtgc cctgtccaac ttcatcaagg 661 acgccgtgct cttctcctca gatgatgtca cctactgcga tgcccacagg gcgggctgca 721 agctgatcat ggtgctgttc cagtactgca tcatggccaa ctactcctgg ctgctggtgg 781 aaggcctcta ccttcacaca ctcctcgcca tctccttctt ctctgaaaga aagtacctcc 841 agggatttgt ggcattcgga tggggttctc cagccatttt tgttgctttg tgggctattg 901 ccagacactt tctggaagat gttgggtgct gggacatcaa tgccaacgca tccatctggt 961 ggatcattcg tggtcctgtg atcctctcca tcctgattaa tttcatcctt ttcataaaca 1021 ttctaagaat ccTGATGAGA AAACTTAGAA CCCAAGAAAC AAGAGGAAAT GAAGTCAGCC 1081 ATTATAAGCG CCTGGCCAGG TCCACTCTCC TGCTGATCCC CCTCTTTGGC ATCCACTACA 1141 TCGTCTTCGC CTTCTCCCCA GAGGACGCTA TGGAGATCCA GCTGTTTTTT GAACTAGCCC 1201 TTGGCTCATT CCAGGGACTG GTGGTGGCCG TCCTCTACTG CTTCCTCAAC GGGGAGGTGC 1261 AGCTGGAGGT TCAGAAGAAG TGGCAGCAAT GGCACCTCCG TGAGTTCCCA CTGCACCCCG 1321 TGGCCTCCTT CAGCAACAGC ACCAAGGCCA GCCACTTGGA GCAGAGCCAG GGCACCTGCA 1381 GGACCAGCAT CATCGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1441 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1501 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TAGATTACTA GTCTCCAAAA 1561 ACCTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt