Construct: ORF TRCN0000489434
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020921.1_s317c1
- DNA Barcode:
- TGACCCGCTTATTCTAAAAAATCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CXCR2 (3579)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489434
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | NM_001168298.2 | 99.9% | 100% | 786C>T |
| 2 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | NM_001557.4 | 99.9% | 100% | 786C>T |
| 3 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_005246530.3 | 99.9% | 100% | 786C>T |
| 4 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003990.1 | 99.9% | 100% | 786C>T |
| 5 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003991.1 | 99.9% | 100% | 786C>T |
| 6 | human | 3579 | CXCR2 | C-X-C motif chemokine recep... | XM_017003992.1 | 99.9% | 100% | 786C>T |
| 7 | human | 3577 | CXCR1 | C-X-C motif chemokine recep... | NM_000634.3 | 81.6% | 75.2% | (many diffs) |
| 8 | human | 3580 | CXCR2P1 | C-X-C motif chemokine recep... | NR_002712.1 | 37.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1152
- ORF length:
- 1080
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggaagat tttaacatgg agagtgacag ctttgaagat ttctggaaag 121 gtgaagatct tagtaattac agttacagct ctaccctgcc cccttttcta ctagatgccg 181 ccccatgtga accagaatcc ctggaaatca acaagtattt tgtggtcatt atctatgccc 241 tggtattcct gctgagcctg ctgggaaact ccctcgtgat gctggtcatc ttatacagca 301 gggtcggccg ctccgtcact gatgtctacc tgctgaacct agccttggcc gacctactct 361 ttgccctgac cttgcccatc tgggccgcct ccaaggtgaa tggctggatt tttggcacat 421 tcctgtgcaa ggtggtctca ctcctgaagg aagtcaactt ctatagtggc atcctgctac 481 tggcctgcat cagtgtggac cgttacctgg ccattgtcca tgccacacgc acactgaccc 541 agaagcgcta cttggtcaaa ttcatatgtc tcagcatctg gggtctgtcc ttgctcctgg 601 ccctgcctgt cttacttttc cgaaggaccg tctactcatc caatgttagc ccagcctgct 661 atgaggacat gggcaacaat acagcaaact ggcggatgct gttacggatc ctgccccagt 721 cctttggctt catcgtgcca ctgctgatca tgctgttctg ctacggattc accctgcgta 781 cgctgtttaa ggcccacatg gggcagaagc accgggCCAT GCGGGTCATC TTTGCTGTCG 841 TCCTCATCTT CCTGCTTTGC TGGCTGCCCT ACAACCTGGT CCTGCTGGCA GACACCCTCA 901 TGAGGACCCA GGTGATCCAG GAGACCTGTG AGCGCCGCAA TCACATCGAC CGGGCTCTGG 961 ATGCCACCGA GATTCTGGGC ATCCTTCACA GCTGCCTCAA CCCCCTCATC TACGCCTTCA 1021 TTGGCCAGAA GTTTCGCCAT GGACTCCTCA AGATTCTAGC TATACATGGC TTGATCAGCA 1081 AGGACTCCCT GCCCAAAGAC AGCAGGCCTT CCTTTGTTGG CTCTTCTTCA GGGCACACTT 1141 CCACTACTCT CTAGGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1201 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1261 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TGACCCGCTT ATTCTAAAAA 1321 ATCGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt