Construct: ORF TRCN0000489522
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020882.1_s317c1
- DNA Barcode:
- TGCTGCTGCGTTAGACCGTGTAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR1 (2825)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489522
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_001098199.1 | 99.9% | 99.7% | 193T>C |
| 2 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_001261452.1 | 99.9% | 99.7% | 193T>C |
| 3 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_001261453.1 | 99.9% | 99.7% | 193T>C |
| 4 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_001261454.1 | 99.9% | 99.7% | 193T>C |
| 5 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_001261455.1 | 99.9% | 99.7% | 193T>C |
| 6 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_005279.3 | 99.9% | 99.7% | 193T>C |
| 7 | human | 2825 | GPR1 | G protein-coupled receptor 1 | XM_005246471.3 | 99.9% | 99.7% | 193T>C |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1137
- ORF length:
- 1065
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggaagat ttggaggaaa cattatttga agaatttgaa aactattcct 121 atgacctaga ctattactct ctggagtctg atttggagga gaaagtccag ctgggagttg 181 ttcactgggt ctccctggtg ttatattgtt tggcttttgt tctgggaatt ccaggaaatg 241 ccatcgtcat ttggttcacg gggctcaagt ggaagaagac agtcaccact ctgtggttcc 301 tcaatctagc cattgcggat ttcatttttc ttctctttct gcccctgtac atctcctatg 361 tggccatgaa tttccactgg ccctttggca tctggctgtg caaagccaat tccttcactg 421 cccagttgaa catgtttgcc agtgtttttt tcctgacagt gatcagcctg gaccactata 481 tccacttgat ccatcctgtc ttatctcatc ggcatcgaac cctcaagaac tctctgattg 541 tcattatatt catctggctt ttggcttctc taattggcgg tcctgccctg tacttccggg 601 acactgtgga gttcaataat catactcttt gctataacaa ttttcagaag catgatcctg 661 acctcacttt gatcaggcac catgttctga cttgggtgaa atttatcatt ggctatctct 721 tccctttgct aacaatgagt atttgctact tgtgtctcat cttcaaggtg aagaagcgaa 781 gcatccTGAT CTCCAGTAGG CATTTCTGGA CAATTCTGGT TGTGGTTGTG GCCTTTGTGG 841 TTTGCTGGAC TCCTTATCAC CTGTTTAGCA TTTGGGAGCT CACCATTCAC CACAATAGCT 901 ATTCCCACCA TGTGATGCAG GCTGGAATCC CCCTCTCCAC TGGTTTGGCA TTCCTCAATA 961 GTTGCTTGAA CCCCATCCTT TATGTCCTAA TTAGTAAGAA GTTCCAAGCT CGCTTCCGGT 1021 CCTCAGTTGC TGAGATACTC AAGTACACAC TGTGGGAAGT CAGCTGTTCT GGCACAGTGA 1081 GTGAACAGCT CAGGAACTCA GAAACCAAGA ATCTGTGTCT CCTGGAAACA GCTCAATAGG 1141 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1201 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1261 TTTATATATC TTGTGGAAAG GACGATGCTG CTGCGTTAGA CCGTGTAACA CGCGTTAAGT 1321 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt