Transcript: Human NM_001098199.1

Homo sapiens G protein-coupled receptor 1 (GPR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
GPR1 (2825)
Length:
2326
CDS:
383..1450

Additional Resources:

NCBI RefSeq record:
NM_001098199.1
NBCI Gene record:
GPR1 (2825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357092 TTAGGAAGGATCCGCATAATT pLKO_005 1676 3UTR 100% 15.000 12.000 N GPR1 n/a
2 TRCN0000357091 CACTATATAGGCATCACATTT pLKO_005 1573 3UTR 100% 13.200 10.560 N GPR1 n/a
3 TRCN0000011497 CCATCCTTTATGTCCTAATTA pLKO.1 1284 CDS 100% 15.000 10.500 N GPR1 n/a
4 TRCN0000357093 ATTCCTATGACCTAGACTATT pLKO_005 426 CDS 100% 13.200 9.240 N GPR1 n/a
5 TRCN0000011493 CGACTCCACTTTCATAGTTAT pLKO.1 1542 3UTR 100% 13.200 9.240 N GPR1 n/a
6 TRCN0000011494 CCCTTTGCTAACAATGAGTAT pLKO.1 1033 CDS 100% 4.950 3.465 N GPR1 n/a
7 TRCN0000011495 CCTGTCTTATCTCATCGGCAT pLKO.1 806 CDS 100% 2.160 1.512 N GPR1 n/a
8 TRCN0000011496 GCTGTGCAAAGCCAATTCCTT pLKO.1 706 CDS 100% 3.000 1.800 N GPR1 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1853 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1853 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489522 TGCTGCTGCGTTAGACCGTGTAAC pLX_317 33.2% 99.9% 99.7% V5 (not translated due to prior stop codon) 193T>C n/a
2 TRCN0000489627 ACCAAGGGCTATAATCGGAACCAG pLX_317 33.3% 99.8% 99.4% V5 193T>C;1065_1066insG n/a
Download CSV