Construct: ORF TRCN0000489627
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019516.1_s317c1
- DNA Barcode:
- ACCAAGGGCTATAATCGGAACCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR1 (2825)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489627
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_001098199.1 | 99.8% | 99.4% | 193T>C;1065_1066insG |
| 2 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_001261452.1 | 99.8% | 99.4% | 193T>C;1065_1066insG |
| 3 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_001261453.1 | 99.8% | 99.4% | 193T>C;1065_1066insG |
| 4 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_001261454.1 | 99.8% | 99.4% | 193T>C;1065_1066insG |
| 5 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_001261455.1 | 99.8% | 99.4% | 193T>C;1065_1066insG |
| 6 | human | 2825 | GPR1 | G protein-coupled receptor 1 | NM_005279.3 | 99.8% | 99.4% | 193T>C;1065_1066insG |
| 7 | human | 2825 | GPR1 | G protein-coupled receptor 1 | XM_005246471.3 | 99.8% | 99.4% | 193T>C;1065_1066insG |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 63
- ORF end:
- 1131
- ORF length:
- 1068
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaagcca 61 ccatggaaga tttggaggaa acattatttg aagaatttga aaactattcc tatgacctag 121 actattactc tctggagtct gatttggagg agaaagtcca gctgggagtt gttcactggg 181 tctccctggt gttatattgt ttggcttttg ttctgggaat tccaggaaat gccatcgtca 241 tttggttcac ggggctcaag tggaagaaga cagtcaccac tctgtggttc ctcaatctag 301 ccattgcgga tttcattttt cttctctttc tgcccctgta catctcctat gtggccatga 361 atttccactg gccctttggc atctggctgt gcaaagccaa ttccttcact gcccagttga 421 acatgtttgc cagtgttttt ttcctgacag tgatcagcct ggaccactat atccacttga 481 tccatcctgt cttatctcat cggcatcgaa ccctcaagaa ctctctgatt gtcattatat 541 tcatctggct tttggcttct ctaattggcg gtcctgccct gtacttccgg gacactgtgg 601 agttcaataa tcatactctt tgctataaca attttcagaa gcatgatcct gacctcactt 661 tgatcaggca ccatgttctg acttgggtga aatttatcat tggctatctc ttccctttgc 721 taacaatgag tatttgctac ttgtgtctca tcttcaaggt gaagaagcga agcatccTGA 781 TCTCCAGTAG GCATTTCTGG ACAATTCTGG TTGTGGTTGT GGCCTTTGTG GTTTGCTGGA 841 CTCCTTATCA CCTGTTTAGC ATTTGGGAGC TCACCATTCA CCACAATAGC TATTCCCACC 901 ATGTGATGCA GGCTGGAATC CCCCTCTCCA CTGGTTTGGC ATTCCTCAAT AGTTGCTTGA 961 ACCCCATCCT TTATGTCCTA ATTAGTAAGA AGTTCCAAGC TCGCTTCCGG TCCTCAGTTG 1021 CTGAGATACT CAAGTACACA CTGTGGGAAG TCAGCTGTTC TGGCACAGTG AGTGAACAGC 1081 TCAGGAACTC AGAAACCAAG AATCTGTGTC TCCTGGAAAC AGCTCAAGAC CCAGCTTTCT 1141 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1201 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1261 GTGGAAAGGA CGAACCAAGG GCTATAATCG GAACCAGACG CGTTAAGTCg acaatcaacc 1321 tctggattac aaaatttgtg aaagatt