Construct: ORF TRCN0000489630
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019341.1_s317c1
- DNA Barcode:
- CGGCTAGCTAAGTAGCTTACCCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR18 (2841)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489630
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2841 | GPR18 | G protein-coupled receptor 18 | NM_001098200.1 | 99.7% | 100% | 992_993delTA |
| 2 | human | 2841 | GPR18 | G protein-coupled receptor 18 | NM_005292.3 | 99.7% | 100% | 992_993delTA |
| 3 | human | 2841 | GPR18 | G protein-coupled receptor 18 | XM_006719946.3 | 99.7% | 100% | 992_993delTA |
| 4 | human | 2841 | GPR18 | G protein-coupled receptor 18 | XM_024449339.1 | 99.7% | 100% | 992_993delTA |
| 5 | mouse | 110168 | Gpr18 | G protein-coupled receptor 18 | NM_182806.1 | 82.4% | 85.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1068
- ORF length:
- 993
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgatc accctgaaca atcaagatca acctgtccct tttaacagct 121 cacatccaga tgaatacaaa attgcagccc ttgtcttcta tagctgtatc ttcataattg 181 gattatttgt taacatcact gcattatggg ttttcagttg taccaccaag aagagaacca 241 cggtaaccat ctatatgatg aatgtggcat tagtggactt gatatttata atgactttac 301 cctttcgaat gttttattat gcaaaagatg aatggccatt tggagagtac ttctgccaga 361 ttcttggagc tctcacagtg ttttacccaa gcattgcttt atggcttctt gcctttatta 421 gtgctgacag atacatggcc attgtacagc cgaagtacgc caaagaactt aaaaacacgt 481 gcaaagccgt gctggcgtgt gtgggagtct ggataatgac cctgaccacg accacccctc 541 tgctactgct ctataaagac ccagataaag actccactcc cgccacctgc ctcaagattt 601 ctgacatcat ctatctaaaa gctgtgaacg tgctgaacct cactcgactg acattttttt 661 tcttgattcc tttgttcatc atgattgggt gctacttGGT CATTATTCAT AATCTCCTTC 721 ACGGCAGGAC GTCTAAGCTG AAACCCAAAG TCAAGGAGAA GTCCATAAGG ATCATCATCA 781 CGCTGCTGGT GCAGGTGCTC GTCTGCTTTA TGCCCTTCCA CATCTGTTTC GCTTTCCTGA 841 TGCTGGGAAC GGGGGAGAAC AGTTACAATC CCTGGGGAGC CTTTACCACC TTCCTCATGA 901 ACCTCAGCAC GTGTCTGGAT GTGATTCTCT ACTACATCGT TTCAAAACAA TTTCAGGCTC 961 GAGTCATTAG TGTCATGCTA TACCGTAATT ACCTTCGAAG CATGCGCAGA AAAAGTTTCC 1021 GATCTGGTAG TCTACGGTCA CTAAGCAATA TAAACAGTGA AATGTTAGAC CCAGCTTTCT 1081 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1141 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1201 GTGGAAAGGA CGACGGCTAG CTAAGTAGCT TACCCTCACG CGTTAAGTCg acaatcaacc 1261 tctggattac aaaatttgtg aaagatt