Construct: ORF TRCN0000489690
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020176.1_s317c1
- DNA Barcode:
- TGCGCCCAGTGAATATCTAAAAAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PRPS1 (5631)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489690
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5631 | PRPS1 | phosphoribosyl pyrophosphat... | NM_002764.4 | 99.5% | 99.3% | 954_954delAinsTTGG |
| 2 | human | 221823 | PRPS1L1 | phosphoribosyl pyrophosphat... | NM_175886.3 | 91.8% | 93.4% | (many diffs) |
| 3 | human | 5631 | PRPS1 | phosphoribosyl pyrophosphat... | NM_001204402.1 | 35.6% | 35.4% | 0_1ins612;342_342delAinsTTGG |
| 4 | mouse | 328099 | Prps1l3 | phosphoribosyl pyrophosphat... | NM_001037746.3 | 92.1% | 99% | (many diffs) |
| 5 | mouse | 19139 | Prps1 | phosphoribosyl pyrophosphat... | NM_021463.4 | 92% | 99.3% | (many diffs) |
| 6 | mouse | 75456 | Prps1l1 | phosphoribosyl pyrophosphat... | NM_029294.2 | 87.4% | 94.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1029
- ORF length:
- 957
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgccgaat atcaaaatct tcagcggcag ctcccaccag gacttatctc 121 agaaaattgc tgaccgcctg ggcctggagc taggcaaggt ggtgactaag aaattcagca 181 accaggagac ctgtgtggaa attggtgaaa gtgtacgtgg agaggatgtc tacattgttc 241 agagtggttg tggcgaaatc aatgacaatt taatggagct tttgatcatg attaatgcct 301 gcaagattgc ttcagccagc cgggttactg cagtcatccc atgcttccct tatgcccggc 361 aggataagaa agataagagc cgggcgccaa tctcagccaa gcttgttgca aatatgctat 421 ctgtagcagg tgcagatcat attatcacca tggacctaca tgcttctcaa attcagggct 481 tttttgatat cccagtagac aatttgtatg cagagccggc tgtcctaaag tggataaggg 541 agaatatctc tgagtggagg aactgcacta ttgtctcacc tgatgctggt ggagcTAAGA 601 GAGTGACCTC CATTGCAGAC AGGCTGAATG TGGACTTTGC CTTGATTCAC AAAGAACGGA 661 AGAAGGCCAA TGAAGTGGAC CGCATGGTGC TTGTGGGAGA TGTGAAGGAT CGGGTGGCCA 721 TCCTTGTGGA TGACATGGCT GACACTTGTG GCACAATCTG CCATGCAGCT GACAAACTTC 781 TCTCAGCTGG CGCCACCAGA GTTTATGCCA TCTTGACTCA TGGAATCTTC TCCGGTCCTG 841 CTATTTCTCG CATCAACAAC GCATGCTTTG AGGCAGTAGT AGTCACCAAT ACCATACCTC 901 AGGAGGACAA GATGAAGCAT TGCTCCAAAA TACAGGTGAT TGACATCTCT ATGATCCTTG 961 CAGAAGCCAT CAGGAGAACT CACAATGGAG AATCCGTTTC TTACCTATTC AGCCATGTCC 1021 CTTTTTGGTG AGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1081 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1141 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATGC GCCCAGTGAA TATCTAAAAA 1201 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t