Construct: ORF TRCN0000489730
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021357.1_s317c1
- DNA Barcode:
- AAATGGTCGATGTCTCAGATACCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- KLK7 (5650)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489730
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5650 | KLK7 | kallikrein related peptidase 7 | NM_005046.4 | 99.8% | 100% | 34T>C |
| 2 | human | 5650 | KLK7 | kallikrein related peptidase 7 | NM_139277.2 | 99.8% | 100% | 34T>C |
| 3 | human | 5650 | KLK7 | kallikrein related peptidase 7 | NM_001207053.2 | 71.5% | 71.5% | 0_1ins216 |
| 4 | human | 5650 | KLK7 | kallikrein related peptidase 7 | NM_001243126.1 | 68.8% | 74.4% | 1_127del;161T>C;200_201ins148 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 831
- ORF length:
- 759
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcaaga tcccttctcc tgcccctgca gatcctactg ctatccttag 121 ccttggaaac tgcaggagaa gaagcccagg gtgacaagat tattgatggc gccccatgtg 181 caagaggctc ccacccatgg caggtggccc tgctcagtgg caatcagctc cactgcggag 241 gcgtcctggt caatgagcgc tgggtgctca ctgccgccca ctgcaagatg aatgagtaca 301 ccgtgcacct gggcagtgat acgctgggcg acaggagagc tcagaggatc aaggcctcga 361 agtcattccg ccaccccggc tactccacac agacccatgt taatgacctc atgctcgtga 421 agctcaatag ccaggCCAGG CTGTCATCCA TGGTGAAGAA AGTCAGGCTG CCCTCCCGCT 481 GCGAACCCCC TGGAACCACC TGTACTGTCT CCGGCTGGGG CACTACCACG AGCCCAGATG 541 TGACCTTTCC CTCTGACCTC ATGTGCGTGG ATGTCAAGCT CATCTCCCCC CAGGACTGCA 601 CGAAGGTTTA CAAGGACTTA CTGGAAAATT CCATGCTGTG CGCTGGCATC CCCGACTCCA 661 AGAAAAACGC CTGCAATGGT GACTCAGGGG GACCGTTGGT GTGCAGAGGT ACCCTGCAAG 721 GTCTGGTGTC CTGGGGAACT TTCCCTTGCG GCCAACCCAA TGACCCAGGA GTCTACACTC 781 AAGTGTGCAA GTTCACCAAG TGGATAAATG ACACCATGAA AAAGCATCGC TAGAACCCAG 841 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 901 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 961 TATCTTGTGG AAAGGACGAA AATGGTCGAT GTCTCAGATA CCCACGCGTT AAGTCgacaa 1021 tcaacctctg gattacaaaa tttgtgaaag att