Transcript: Human NM_001207053.2

Homo sapiens kallikrein related peptidase 7 (KLK7), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
KLK7 (5650)
Length:
1824
CDS:
211..756

Additional Resources:

NCBI RefSeq record:
NM_001207053.2
NBCI Gene record:
KLK7 (5650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001207053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046869 GACCCATGTTAATGACCTCAT pLKO.1 315 CDS 100% 4.050 5.670 N KLK7 n/a
2 TRCN0000372754 TAACGCCACACTGAGTTAATT pLKO_005 754 CDS 100% 15.000 10.500 N KLK7 n/a
3 TRCN0000372713 CGATGACCTATGAAGTCAAAT pLKO_005 817 3UTR 100% 13.200 9.240 N KLK7 n/a
4 TRCN0000372753 CTTTGACCCAGTAACTCTAAT pLKO_005 1063 3UTR 100% 13.200 9.240 N KLK7 n/a
5 TRCN0000046871 CAGGGTGACAAGATTATTGAT pLKO.1 70 5UTR 100% 5.625 3.938 N KLK7 n/a
6 TRCN0000046872 GCTGTCATCCATGGTGAAGAA pLKO.1 363 CDS 100% 4.950 3.465 N KLK7 n/a
7 TRCN0000046870 CAAGTGGATAAATGACACCAT pLKO.1 720 CDS 100% 2.640 1.848 N KLK7 n/a
8 TRCN0000046868 CCCTGTTGATAAACCAATCAA pLKO.1 882 3UTR 100% 0.563 0.394 N KLK7 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1417 3UTR 100% 4.950 2.475 Y n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1490 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1490 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001207053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06787 pDONR223 100% 71.5% 71.5% None 0_1ins216 n/a
2 ccsbBroad304_06787 pLX_304 0% 71.5% 71.5% V5 0_1ins216 n/a
3 TRCN0000466526 TATTTTCCCCCACATTCGAGTGTT pLX_317 55.5% 71.5% 71.5% V5 0_1ins216 n/a
4 TRCN0000489730 AAATGGTCGATGTCTCAGATACCC pLX_317 51.9% 71.5% 71.5% V5 (not translated due to prior stop codon) 0_1ins216 n/a
Download CSV