Construct: ORF TRCN0000489737
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020792.1_s317c1
- DNA Barcode:
- GCAGAGAATCCCACAGGCCATGTG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR160 (26996)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489737
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26996 | GPR160 | G protein-coupled receptor 160 | NM_014373.3 | 100% | 100% | |
| 2 | human | 26996 | GPR160 | G protein-coupled receptor 160 | XM_005247346.4 | 100% | 100% | |
| 3 | human | 26996 | GPR160 | G protein-coupled receptor 160 | XM_005247347.4 | 100% | 100% | |
| 4 | human | 26996 | GPR160 | G protein-coupled receptor 160 | XM_017006161.2 | 100% | 100% | |
| 5 | human | 26996 | GPR160 | G protein-coupled receptor 160 | XM_024453449.1 | 100% | 100% | |
| 6 | human | 26996 | GPR160 | G protein-coupled receptor 160 | XM_024453450.1 | 100% | 100% | |
| 7 | human | 26996 | GPR160 | G protein-coupled receptor 160 | XM_024453451.1 | 100% | 100% |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1086
- ORF length:
- 1014
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgactgct ctctcttcag agaactgctc ttttcagtac cagttacgtc 121 aaacaaacca gcccctagat gttaactatc tgctattctt gatcatactt gggaaaatat 181 tattaaatat ccttacacta ggaatgagaa gaaaaaacac ctgtcaaaat tttatggaat 241 atttttgcat ttcactagca ttcgttgatc ttttactttt ggtaaacatt tccattatat 301 tgtatttcag ggattttgta cttttaagca ttaggttcac taaataccac atctgcctat 361 ttactcaaat tatttccttt acttatggct ttttgcatta tccagttttc ctgacagctt 421 gtatagatta ttgcctgaat ttctctaaaa caaccaagct ttcatttaag tgtcaaaaat 481 tattttattt ctttacagta attttaattt ggatttcagt ccttgcttat gttttgggag 541 acccagccat ctaccaaagc ctgaaggcac agaatgctta ttctcgtcac tgtcctttct 601 atgtcagcat tcagagttac tggctgtcat ttttcatggt gatgatttta tttgtagctt 661 tcataaCCTG TTGGGAAGAA GTTACTACTT TGGTACAGGC TATCAGGATA ACTTCCTATA 721 TGAATGAAAC TATCTTATAT TTTCCTTTTT CATCCCACTC CAGTTATACT GTGAGATCTA 781 AAAAAATATT CTTATCCAAG CTCATTGTCT GTTTTCTCAG TACCTGGTTA CCATTTGTAC 841 TACTTCAGGT AATCATTGTT TTACTTAAAG TTCAGATTCC AGCATATATT GAGATGAATA 901 TTCCCTGGTT ATACTTTGTC AATAGTTTTC TCATTGCTAC AGTGTATTGG TTTAATTGTC 961 ACAAGCTTAA TTTAAAAGAC ATTGGATTAC CTTTGGATCC ATTTGTCAAC TGGAAGTGCT 1021 GCTTCATTCC ACTTACAATT CCTAATCTTG AGCAAATTGA AAAGCCTATA TCAATAATGA 1081 TTTGTTAGGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1141 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1201 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGCAGAG AATCCCACAG GCCATGTGAC 1261 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt