Transcript: Human XM_017006161.2

PREDICTED: Homo sapiens G protein-coupled receptor 160 (GPR160), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR160 (26996)
Length:
2138
CDS:
694..1710

Additional Resources:

NCBI RefSeq record:
XM_017006161.2
NBCI Gene record:
GPR160 (26996)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006161.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011487 GCTACAGTGTATTGGTTTAAT pLKO.1 1558 CDS 100% 15.000 21.000 N GPR160 n/a
2 TRCN0000011485 CCTGGTTATACTTTGTCAATA pLKO.1 1526 CDS 100% 13.200 18.480 N GPR160 n/a
3 TRCN0000368415 TTAAGCATTAGGTTCACTAAA pLKO_005 946 CDS 100% 13.200 18.480 N GPR160 n/a
4 TRCN0000011484 CCACTTACAATTCCTAATCTT pLKO.1 1651 CDS 100% 5.625 7.875 N GPR160 n/a
5 TRCN0000011486 GCTATCAGGATAACTTCCTAT pLKO.1 1321 CDS 100% 4.950 6.930 N GPR160 n/a
6 TRCN0000368463 GGGCTATGATACCAGTTATTA pLKO_005 1849 3UTR 100% 15.000 12.000 N GPR160 n/a
7 TRCN0000357060 AGTTATACTGTGAGATCTAAA pLKO_005 1384 CDS 100% 13.200 9.240 N GPR160 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006161.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02981 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02981 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477914 ATGCTAGCATCTCTAATGTGGCCA pLX_317 41% 100% 100% V5 n/a
4 TRCN0000489737 GCAGAGAATCCCACAGGCCATGTG pLX_317 41.5% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV